STMN2-stathmin-like 2 Gene View larger

STMN2-stathmin-like 2 Gene

PTXBC006302

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STMN2-stathmin-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STMN2-stathmin-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006302
Product type: DNA & cDNA
Ncbi symbol: STMN2
Origin species: Human
Product name: STMN2-stathmin-like 2 Gene
Size: 2ug
Accessions: BC006302
Gene id: 11075
Gene description: stathmin-like 2
Synonyms: SCGN10; stathmin-2; neuron-specific growth-associated protein; neuronal growth-associated protein (silencer element); stathmin-like 2; superior cervical ganglia, neural specific 10; superior cervical ganglion-10 protein; stathmin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaaaacagcaatggcctacaaggaaaaaatgaaggagctgtccatgctgtcactgatctgctcttgcttttacccggaacctcgcaacatcaacatctatacttacgatgatatggaagtgaagcaaatcaacaaacgtgcctctggccaggcttttgagctgatcttgaagccaccatctcctatctcagaagccccacgaactttagcttctccaaagaagaaagacctgtccctggaggagatccagaagaaactggaggctgcagaggaaagaagaaagtctcaggaggcccaggtgctgaaacaattggcagagaagagggaacacgagcgagaagtccttcagaaggctttggaggagaacaacaacttcagcaagatggcggaggaaaagctgatcctgaaaatggaacaaattaaggaaaaccgtgaggctaatctagctgctattattgaacgtctgcaggaaaaggagaggcatgctgcggaggtgcgcaggaacaaggaactccaggttgaactgtctggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microcephalin 1
- protocadherin 1
- FK506 binding protein 1B, 12.6 kDa
- Rho GTPase activating protein 17

Reviews

Buy STMN2-stathmin-like 2 Gene now

Add to cart