Cart 4 Product Products 477,90 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 € -
1 x AVL9-AVL9...121,50 € -
1 x CCDC51-coi...121,50 €
No products
To be determined Shipping
477,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 477,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 477,90 €
View larger 
Data sheet of LTA-lymphotoxin alpha (TNF superfamily, member 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LTA-lymphotoxin alpha (TNF superfamily, member 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034729 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LTA |
| Origin species: | Human |
| Product name: | LTA-lymphotoxin alpha (TNF superfamily, member 1) Gene |
| Size: | 2ug |
| Accessions: | BC034729 |
| Gene id: | 4049 |
| Gene description: | lymphotoxin alpha (TNF superfamily, member 1) |
| Synonyms: | TNFB; TNFSF1; TNLG1E; lymphotoxin-alpha; LT-alpha; TNF superfamily, member 1; TNF-beta; tumor necrosis factor beta; tumor necrosis factor ligand 1E; tumor necrosis factor ligand superfamily member 1; lymphotoxin alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaccacctgaacgtctcttcctcccaagggtgcgtggcaccaccctacacctcctccttctggggctgctgctggttctgctgcctggggcccaggggctccctggtgttggcctcacaccttcagctgcccagactgcccgtcagcaccccaagatgcatcttgcccacagcaccctcaaacctgctgctcacctcattggagaccccagcaagcagaactcactgctctggagagcaaacacggaccgtgccttcctccaggatggtttctccttgagcaacaattctctcctggtccccaccagtggcatctacttcgtctactcccaggtggtcttctctgggaaagcctactctcccaaggccacctcctccccactctacctggcccatgaggtccagctcttctcctcccagtaccccttccatgtgcctctcctcagctcccagaagatggtgtatccagggctgcaggaaccctggctgcactcgatgtaccacggggctgcgttccagctcacccagggagaccagctatccacccacacagatggcatcccccacctagtcctcagccctagtactgtcttctttggagccttcgctctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger and SCAN domain containing 5A - germ cell-less homolog 1 (Drosophila)-like - phenylalanyl-tRNA synthetase, alpha subunit - peptidylglycine alpha-amidating monooxygenase |