Cart 6 Product Products 695,92 € (empty)
-
1 x IMPACT-Imp...121,50 € -
-
1 x C4orf12-ch...113,40 € -
-
1 x REXO1L2P-R...121,50 € -
1 x CX3CR1-che...121,50 €
No products
To be determined Shipping
695,92 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 695,92 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 695,92 €
Data sheet of FREQ-frequenin homolog (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FREQ-frequenin homolog (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004856 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FREQ |
| Origin species: | Human |
| Product name: | FREQ-frequenin homolog (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC004856 |
| Gene id: | 23413 |
| Gene description: | frequenin homolog (Drosophila) |
| Synonyms: | FREQ; FLUP; neuronal calcium sensor 1; frequenin homolog; frequenin-like protein; frequenin-like ubiquitous protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaaatccaacagcaagttgaagcccgaagttgtggaggagctgaccaggaagacctactttaccgagaaggaggtccagcagtggtacaaaggcttcatcaaggactgccccagtgggcagctggatgcggcaggcttccagaagatctacaagcaattcttcccgttcggagaccccaccaagtttgccacatttgttttcaacgtctttgatgaaaacaaggacgggcgaattgagttctccgagttcatccaggcgctgtcggtgacctcacggggaaccctggatgagaagctacggtgggccttcaagctctacgacttggacaatgatggctacatcaccaggaatgagatgctggacattgtggatgccatttaccagatggtggggaataccgtggagctcccagaggaggagaacactcctgagaagagggtggaccggatctttgccatgatggataagaatgccgacgggaagctgaccctgcaggagttccaggaggggtccaaggcagacccgtccattgtgcaggcgctgtccctctacgacgggctggtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alpha-methylacyl-CoA racemase - prune homolog 2 (Drosophila) - ADP-ribosylation factor-like 1 - armadillo repeat containing 9 |