Cart 1 Product Products 102,78 € (empty)
No products
To be determined Shipping
102,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 102,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 102,78 €
Data sheet of MRPS11-mitochondrial ribosomal protein S11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS11-mitochondrial ribosomal protein S11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012489 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS11 |
| Origin species: | Human |
| Product name: | MRPS11-mitochondrial ribosomal protein S11 Gene |
| Size: | 2ug |
| Accessions: | BC012489 |
| Gene id: | 64963 |
| Gene description: | mitochondrial ribosomal protein S11 |
| Synonyms: | HCC-2; MRP-S11; S11mt; 28S ribosomal protein S11, mitochondrial; cervical cancer proto-oncogene 2 protein; mitochondrial ribosomal protein S11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaggctgtgagaaacgcggggtcgcggttcctgcggtcctggacttggccccagacagccggggtcgtggccagaacgccggccgggaccatctgcacaggcgctcgacagctccaagacgctgcggccaagcagaaagttgaacagaacgcggctcccagccacaccaagttcagcatttaccctcccattccaggagaggagagctctctgaggtgggcaggaaagaaatttgaggagatcccaattgcacacattaaagcatcccacaacaacacacagatccaggtagtctctgctagtaatgagccccttgcctttgcttcctgtggcacagagggatttcggaatgccaagaagggcacaggcatcgcagcacagacagcaggcatagccgcagcggcgagagctaaacaaaagggcgtgatccacatccgagttgtggtgaaaggcctggggccaggacgcttgtctgccatgcacggactgatcatgggcggcctggaagtgatctcaatcacagacaacaccccaatcccacacaacggctgccgccccaggaaggctcggaagctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 86 - deoxynucleotidyltransferase, terminal - chromosome 3 open reading frame 44 - ribosomal protein S6 kinase-like 1 |