Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM174A-family with sequence similarity 174, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM174A-family with sequence similarity 174, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027332 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM174A |
| Origin species: | Human |
| Product name: | FAM174A-family with sequence similarity 174, member A Gene |
| Size: | 2ug |
| Accessions: | BC027332 |
| Gene id: | 345757 |
| Gene description: | family with sequence similarity 174, member A |
| Synonyms: | membrane protein FAM174A; 2310044D20Rik; Fam174; Naa6; Tmem157; transmembrane protein 157; family with sequence similarity 174, member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggcctcgcagtgctgctgctgtctcagccacctcttggcttccgtcctcctcctgctgttgctgcctgaactaagcgggcccctggcagtcctgctgcaggcagccgaggccgcgccaggtcttgggcctcctgaccctagaccacggacattaccgccgctgccaccgggccctacccctgcccagcagccgggccgtggtctggctgaagctgcggggccgcggggctccgagggaggcaatggcagcaaccctgtggccgggcttgagacggacgatcacggagggaaggccggggaaggctcggtgggtggcggccttgctgtgagccccaaccctggcgacaagcccatgacccagcgggccctgaccgtgttgatggtggtgagcggcgcggtgctggtgtacttcgtggtcaggacggtcaggatgagaagaagaaaccgaaagactaggagatatggagttttggacactaacatagaaaatatggaattgacacctttagaacaggatgatgaggatgatgacaacacgttgtttgatgccaatcatcctcgaagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldehyde dehydrogenase 2 family (mitochondrial) - family with sequence similarity 13, member C1 - v-raf murine sarcoma 3611 viral oncogene homolog - echinoderm microtubule associated protein like 1 |