Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT16L1-nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 Gene
PTXBC006223
New product
Data sheet of NUDT16L1-nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT16L1-nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006223 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT16L1 |
| Origin species: | Human |
| Product name: | NUDT16L1-nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC006223 |
| Gene id: | 84309 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 |
| Synonyms: | SDOS; protein syndesmos; NUDT16-like protein 1; nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1; syndesmos; nudix hydrolase 16 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgacggcggcggttccggagctgaagcagatcagccgggtggaggcgatgcgcctagggccgggctggagccactcgtgccacgccatgctgtacgccgccaaccctgggcagctcttcggccgcatccccatgcgcttctcggtgctgatgcagatgcgtttcgacgggctgctgggcttccccgggggcttcgtggaccggcgcttctggtcgctggaggacggcctgaaccgggtgctgggcctgggcctgggctgcctgcgcctcaccgaggccgactacctgagctcgcacctgaccgagggcccacaccgcgtcgtggcgcacctgtacgcgcggcagctgacgctggagcagctgcacgccgtggagatcagcgcggtgcactcgcgcgaccacggcctggaggtgctgggcctcgtgcgggtcccgctgtacacccagaaggaccgagtcggaggcttccccaacttcctgagcaacgccttcgtgagcacggctaagtgccagctcctctttgccctcaaggtgctcaacatgatgcccgaggagaagctggttgaggccctggctgcagccaccgagaagcagaagaaggccctggagaagttgctcccggcctcctcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform - UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) - solute carrier family 12 (potassium/chloride transporters), member 4 - solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 |