> >>YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene
YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene View larger

YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene

PTXBC007319

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007319
Product type: DNA & cDNA
Ncbi symbol: YKT6
Origin species: Human
Product name: YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007319
Gene id: 10652
Gene description: YKT6 v-SNARE homolog (S. cerevisiae)
Synonyms: YKT6 v-SNARE homolog (S. cerevisiae); YKT6, S. cerevisiae, homolog of; YKT6 v-SNARE protein; SNARE protein Ykt6; synaptobrevin homolog YKT6; R-SNARE
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgtacagcctcagcgtcctctacaaaggcgaggccaaggtggtgctgctcaaagccgcatacgatgtgtcttccttcagctttttccagagatccagcgttcaggaattcatgaccttcacgagtcaactgattgtggagcgctcatcgaaaggcactagagcttctgtcaaagaacaagactatctgtgccacgtctacgtccggaatgatagtcttgcaggtgtggtcattgctgacaatgaatacccatcccgggtggcctttaccttgctggagaaggtactagatgaattctccaagcaagtcgacaggatagactggccagtaggatcccctgctacaatccattacccagccctggatggtcacctcagtagataccagaacccacgagaagctgatcccatgactaaagtgcaggccgaactagatgagaccaaaatcattctgcacaacaccatggagtctctgttagagcgaggtgagaagctagatgacttggtgtccaaatccgaggtgctgggaacacagtctaaagccttctataaaactgcccggaaacaaaactcatgctgtgccatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aminolevulinate, delta-, synthase 2
- baculoviral IAP repeat-containing 2
- Mdm1 nuclear protein homolog (mouse)
- coiled-coil domain containing 110

Reviews

Buy YKT6-YKT6 v-SNARE homolog (S. cerevisiae) Gene now

Add to cart