PTXBC017694
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017694 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM128B |
Origin species: | Human |
Product name: | FAM128B-family with sequence similarity 128, member B Gene |
Size: | 2ug |
Accessions: | BC017694 |
Gene id: | 80097 |
Gene description: | family with sequence similarity 128, member B |
Synonyms: | FAM128B; MOZART2B; mitotic-spindle organizing protein 2B; family with sequence similarity 128, member B; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B; mitotic spindle organizing protein 2B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgttgcttctgctcccgatggctctctctgaaatgcagcacaacctcctaggccaatggaagaaggcccagagctggctccctgcctggaagcacgaggagacccgcacaggcatcctgagaaggcgtggagagcaggctgccttcatggggggagtgccagggcctgggcacccacacccgctgacccaagagggcccgggcacctgcgtgctggcctcttcactgaccttcgctctgtctgctctctttgtgtctctctctgacctccagaggcctcctttctctctgccaggaacagtagcccccctgcaaggccctccttttcctccagcccgcagcctgcggcctctccggttctgctccacagcccggctgccacacactcgcctctctctccaggccccccgggttccctccgcctctcttgctgcctgttctctccttttgcaggttgcgtttattggcttatctctgggggttggtgctctcccttgtttccatggaaactgcctggccccaggaggcccaagcagctttgagctccaagggcaggaccatgcaggccatcgctgccctgccgcttag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 174, member A - aldehyde dehydrogenase 2 family (mitochondrial) - family with sequence similarity 13, member C1 - v-raf murine sarcoma 3611 viral oncogene homolog |