Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
Data sheet of BAK1-BCL2-antagonist/killer 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BAK1-BCL2-antagonist/killer 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004431 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BAK1 |
| Origin species: | Human |
| Product name: | BAK1-BCL2-antagonist/killer 1 Gene |
| Size: | 2ug |
| Accessions: | BC004431 |
| Gene id: | 578 |
| Gene description: | BCL2-antagonist/killer 1 |
| Synonyms: | BAK-LIKE; BCL2L7; CDN1; bcl-2 homologous antagonist/killer; BCL2-like 7 protein; apoptosis regulator BAK; bcl-2-like protein 7; bcl2-L-7; pro-apoptotic protein BAK; BCL2 antagonist/killer 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcggggcaaggcccaggtcctcccaggcaggagtgcggagagcctgccctgccctctgcttctgaggagcaggtagcccaggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggtggctgcccctgccgacccagagatggtcaccttacctctgcaacctagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacgacatcaaccgacgctatgactcagagttccagaccatgttgcagcacctgcagcccacggcagagaatgcctatgagtacttcaccaagattgccaccagcctgtttgagagtggcatcaattggggccgtgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcatggcctgactggcttcctaggccaggtgacccgcttcgtggtcgacttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 21 receptor - PDZ domain containing 1 - Ras and Rab interactor 1 - mutS homolog 5 (E. coli) |