> >>SAR1B-SAR1 homolog B (S. cerevisiae) Gene
SAR1B-SAR1 homolog B (S. cerevisiae) Gene View larger

SAR1B-SAR1 homolog B (S. cerevisiae) Gene

PTXBC002847

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SAR1B-SAR1 homolog B (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SAR1B-SAR1 homolog B (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002847
Product type: DNA & cDNA
Ncbi symbol: SAR1B
Origin species: Human
Product name: SAR1B-SAR1 homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC002847
Gene id: 51128
Gene description: SAR1 homolog B (S. cerevisiae)
Synonyms: GTP-binding protein SAR1b; ANDD; CMRD; GTBPB; SARA2; 2310075M17Rik; GTP-binding protein B; GTP-binding protein Sara; SAR1 homolog B; SAR1a gene homolog 2; secretion associated Ras related GTPase 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccttcatatttgattggatttacagtggtttcagcagtgtgctacagtttttaggattatataagaaaactggtaaactggtatttcttggattggataatgcaggaaaaacaacattgctacacatgctaaaagatgacagacttggacaacatgtcccaacattacatcccacttccgaagaactgaccattgctggcatgacgtttacaacttttgatctgggtggacatgttcaagctcgaagagtgtggaaaaactaccttcctgctatcaatggcattgtatttctggtggattgtgcagaccacgaaaggctgttagagtcaaaagaagaacttgattcactaatgacagatgaaaccattgctaatgtgcctatactgattcttgggaataagatcgacagacctgaagccatcagtgaagagaggttgcgagagatgtttggtttatatggtcagacaacaggaaaggggagtatatctctgaaagaactgaatgcccgacccttagaagttttcatgtgtagtgtgctcaaaagacaaggttacggagaaggcttccgctggatggcacagtacattgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-glucose pyrophosphorylase 2
- integrator complex subunit 10
- ADAM metallopeptidase domain 2
- leucine rich repeat neuronal 1

Reviews

Buy SAR1B-SAR1 homolog B (S. cerevisiae) Gene now

Add to cart