Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NKIRAS2-NFKB inhibitor interacting Ras-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NKIRAS2-NFKB inhibitor interacting Ras-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007450 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NKIRAS2 |
| Origin species: | Human |
| Product name: | NKIRAS2-NFKB inhibitor interacting Ras-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC007450 |
| Gene id: | 28511 |
| Gene description: | NFKB inhibitor interacting Ras-like 2 |
| Synonyms: | KBRAS2; kappaB-Ras2; NF-kappa-B inhibitor-interacting Ras-like protein 2; I-kappa-B-interacting Ras-like protein 2; NFKB inhibitor interacting Ras-like protein 2; kappa B-Ras protein 2; NFKB inhibitor interacting Ras like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaagagctgcaaggtggtcgtgtgtggccaggcgtctgtgggcaaaacttcaatcctggagcagcttctgtatgggaaccatgtagtgggttcggagatgatcgagacgcaggaggacatctacgtgggctccattgagacagaccggggggtgcgagagcaggtgcgtttctatgacacccgggggctccgagatggggccgaactgccccgacactgcttctcttgcactgatggctacgtcctggtctatagcacagatagcagagagtcttttcagcgtgtggagctgctcaagaaggagattgacaaatccaaggacaagaaggaggtcaccatcgtggtccttggcaacaagtgtgacttacaggagcagcggcgtgtagacccagatgtggctcagcactgggccaagtcagagaaggtgaagctgtgggaggtgtcagtggcggaccggcgctccctcctggagccctttgtctacttggccagcaagatgacgcaaccccagagcaagtctgccttccccctcagccggaagaacaagggcagcggctccttggatggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CASP8 and FADD-like apoptosis regulator - ankyrin repeat and SOCS box-containing 3 - heat shock 60kDa protein 1 (chaperonin) - fermitin family homolog 3 (Drosophila) |