PTXBC029566
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC029566 |
Product type: | DNA & cDNA |
Ncbi symbol: | DMRTB1 |
Origin species: | Human |
Product name: | DMRTB1-DMRT-like family B with proline-rich C-terminal, 1 Gene |
Size: | 2ug |
Accessions: | BC029566 |
Gene id: | 63948 |
Gene description: | DMRT-like family B with proline-rich C-terminal, 1 |
Synonyms: | doublesex- and mab-3-related transcription factor B1; DMRT like family B with proline rich C-terminal 1 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcccagccttgcgggacccccttttggggcggaggccgcaggcagtggctaccctggccccctagacctgcgcaggccgatgcggaccgtgcccggcccactgttcaccgactttgtgcgccctctgaacatcaacccggaccgtgcactgggccctgagtaccctggtggctccagcatgcacccctactgcccgttcccgctgggctacctggacgcccctcctggcgtccccctgcagcagggcttccggcatgtgtcccgcagccagtaccaaggcggaggcttggtgtcagaaccaggaggagacttccagccaagctactacctgccgccgccgccgccgccactgccgccccttccaccgcttccaccgcagccccagttcctcccgccaggctacctctctgcgctccacttcctccccccgccaccgccaccaccacctccatcatctttctcactgaccgtcctgtttgatactgacaaggagaacactgatgaccaggatgcagaggtactgtcgggtgagcccagccagccatcgtctcaggagcagtccgactag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - integrin beta 3 binding protein (beta3-endonexin) - vacuolar protein sorting 45 homolog (S. cerevisiae) - heterogeneous nuclear ribonucleoprotein U-like 1 - vacuolar protein sorting 39 homolog (S. cerevisiae) |