Cart 15 Product Products 1 710,85 € (empty)
-
1 x SDF2-strom...113,40 € -
1 x AGK-acylgl...121,50 € -
1 x SNX22-sort...113,40 € -
1 x CLDN15-cla...113,40 € -
1 x KCTD13-pot...121,50 € -
1 x UQCR-ubiqu...113,40 € -
-
1 x C1GALT1C1-...121,50 € -
1 x C4orf39-ch...113,40 € -
1 x RRAGD-Ras-...113,40 € -
1 x FANK1-fibr...121,50 € -
1 x FBXW5-F-bo...113,40 € -
1 x IQCF1-IQ...113,40 € -
1 x SOX2-SRY...121,50 € -
1 x CGB-chorio...113,40 €
No products
To be determined Shipping
1 710,85 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 710,85 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 710,85 €
Data sheet of TMEM140-transmembrane protein 140 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM140-transmembrane protein 140 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020942 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM140 |
| Origin species: | Human |
| Product name: | TMEM140-transmembrane protein 140 Gene |
| Size: | 2ug |
| Accessions: | BC020942 |
| Gene id: | 55281 |
| Gene description: | transmembrane protein 140 |
| Synonyms: | transmembrane protein 140 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccggcccaaggcctcagtggcgcgacgagctgctgttcatgagcatcatagtcctcgtgattgtggtcatctgcctgatgttatacgctcttctctgggaggctggcaacctcactgacctgcccaacctgagaatcggcttctataacttctgcctgtggaatgaggacaccagcaccctacagtgtcaccagttccctgagctggaagccctgggggtgcctcgggttggcctgggcctggccaggcttggcgtgtacgggtccctggtcctcaccctctttgccccccagcctctcctcctagcccagtgcaacagtgatgagagagcgtggcggctggcagtgggcttcctggctgtgtcctctgtgctgctggccggcggcctgggcctcttcctctcctatgtgtggaagtgggtcaggctctccctcccggggcctgggtttctagctctgggcagcgcccaggccttactcatcctcttgcttatagccatggctgtgttccctctgagggctgagagggctgagagcaagcttgagagctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PQ loop repeat containing 3 - mediator complex subunit 18 - cysteine dioxygenase, type I - transmembrane protein 165 |