PTXBC001125
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001125 |
Product type: | DNA & cDNA |
Ncbi symbol: | PPIB |
Origin species: | Human |
Product name: | PPIB-peptidylprolyl isomerase B (cyclophilin B) Gene |
Size: | 2ug |
Accessions: | BC001125 |
Gene id: | 5479 |
Gene description: | peptidylprolyl isomerase B (cyclophilin B) |
Synonyms: | CYP-S1; CYPB; HEL-S-39; OI9; SCYLP; peptidyl-prolyl cis-trans isomerase B; PPIase B; S-cyclophilin; cyclophilin-like protein; epididymis secretory protein Li 39; peptidylprolyl isomerase B (cyclophilin B); rotamase B; peptidylprolyl isomerase B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgctgcgcctctccgaacgcaacatgaaggtgctccttgccgccgccctcatcgcggggtccgtcttcttcctgctgctgccgggaccttctgcggccgatgagaagaagaaggggcccaaagtcaccgtcaaggtgtattttgacctacgaattggagatgaagatgtaggccgggtgatctttggtctcttcggaaagactgttccaaaaacagtggataattttgtggccttagctacaggagagaaaggatttggctacaaaaacagcaaattccatcgtgtaatcaaggacttcatgatccagggcggagacttcaccaggggagatggcacaggaggaaagagcatctacggtgagcgcttccccgatgagaacttcaaactgaagcactacgggcctggctgggtgagcatggccaacgcaggcaaagacaccaacggctcccagttcttcatcacgacagtcaagacagcctggctagatggcaagcatgtggtgtttggcaaagttctagagggcatggaggtggtgcggaaggtggagagcaccaagacagacagccgggataaacccctgaaggatgtgatcatcgcagactgcggcaagatcgaggtggagaagccctttgccatcgccaaggagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - F-box and WD repeat domain containing 11 - lymphocyte-specific protein tyrosine kinase - spermidine/spermine N1-acetyltransferase 1 - F-box and leucine-rich repeat protein 13 |