Cart 11 Product Products 1 320,30 € (empty)
-
1 x USH1G-Ushe...121,50 € -
1 x H3F3A-H3...113,40 € -
1 x SNX15-sort...121,50 € -
1 x PPP1R8-pro...113,40 € -
1 x LASS4-LAG1...121,50 € -
1 x SMAD9-SMAD...121,50 € -
1 x RPSA-ribos...121,50 € -
1 x MSL1-male-...121,50 € -
1 x BCL2L14-BC...121,50 € -
1 x VRK1-vacci...121,50 € -
1 x VASH1-vaso...121,50 €
No products
To be determined Shipping
1 320,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 320,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 320,30 €
View larger 
Data sheet of PLLP-plasma membrane proteolipid (plasmolipin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLLP-plasma membrane proteolipid (plasmolipin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002760 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLLP |
| Origin species: | Human |
| Product name: | PLLP-plasma membrane proteolipid (plasmolipin) Gene |
| Size: | 2ug |
| Accessions: | BC002760 |
| Gene id: | 51090 |
| Gene description: | plasma membrane proteolipid (plasmolipin) |
| Synonyms: | PMLP; TM4SF11; plasma membrane proteolipid (plasmolipin); transmembrane 4 superfamily member 11 (plasmolipin) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgagttcccgtcgaaagttagcacgcggaccagcagtcctgcgcagggcgccgaagcctcggtgtcggcgctgcgcccggacctgggcttcgtgcgctcccgcctcggggcgctcatgctgctgcagctggtgctggggctgctggtgtgggcgctgattgcggacaccccgtaccacctgtatccggcctatggctgggtgatgttcgtcgctgtcttcctctggctggtgacaatcgtcctcttcaacctctacctgtttcagctgcacatgaagttgtacatggttccctggccactggtgttaatgatctttaacatcagcgccaccgttctctacatcaccgccttcatcgcctgctctgcggcagttgacctgacatccctgaggggcacccggccttataaccagcgcgcggctgcctcgttctttgcgtgtttggtgatgatcgcctatggagtgagtgccttcttcagctaccaggcctggcgaggagtaggcagcaatgcggccaccagtcagatggctggcggctatgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 14 open reading frame 139 - zinc finger, MYND domain containing 11 - guanine nucleotide binding protein-like 1 - similar to Dynein heavy chain at 16F |