Cart 1 Product Products 121,50 € (empty)
-
1 x LMBR1L-lim...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of MRPL13-mitochondrial ribosomal protein L13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL13-mitochondrial ribosomal protein L13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL13 |
| Origin species: | Human |
| Product name: | MRPL13-mitochondrial ribosomal protein L13 Gene |
| Size: | 2ug |
| Accessions: | BC009190 |
| Gene id: | 28998 |
| Gene description: | mitochondrial ribosomal protein L13 |
| Synonyms: | L13; L13A; L13mt; RPL13; RPML13; 39S ribosomal protein L13, mitochondrial; MRP-L13; mitochondrial ribosomal protein L13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgagtttctctagggcgccccagcaatgggccacttttgctagaatatggtatctcttagatgggaaaatgcagccacctggcaaacttgctgctatggcatctataagacttcagggattacataaacctgtgtaccatgcactgagtgactgtggggatcatgttgttataatgaacacaagacacattgcattttctggaaacaaatgggaacaaaaagtatactcttcgcatactggctacccaggtggatttagacaagtaacagctgctcagcttcacctgagggatccagtggcaattgtaaaactagctatttatggcatgctgccaaaaaaccttcacagaagaacaatgatggaaaggttgcatctttttccagatgagtatattccagaagatattcttaagaatttagtagaggagcttcctcaaccacgaaaaatacctaaacgtctagatgagtacacacaagaagaaatagacgccttcccaagattgtggactccacctgaagattatcggctataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 64 - chromosome 16 open reading frame 5 - mitochondrial ribosomal protein S11 - chromosome 9 open reading frame 86 |