EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene

View larger

EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene

Reference: PTXBC031042

Condition: New product

Print

Data sheet of EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC031042
Product type:	DNA & cDNA
Ncbi symbol:	EPB41L4A
Origin species:	Human
Product name:	EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene
Size:	2ug
Accessions:	BC031042
Gene id:	64097
Gene description:	erythrocyte membrane protein band 4.1 like 4A
Synonyms:	EPB41L4; NBL4; band 4.1-like protein 4A; erythrocyte protein band 4.1-like 4; erythrocyte membrane protein band 4.1 like 4A
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgggctgtttctgcgctgttccggaagaattttactgcgaagttttgctcctggatgaatccaagttaacccttaccacccagcagcagggcatcaagaagtcaacgaaaggttccgttgtccttgaccacgtattccatcacgtaaaccttgtggagatagattattttgggctacgttactgtgacagaagccatcagacgtattggctggatcctgcaaaaacccttgctgaacacaaagaactgatcaacactggacctccatatactttgtattttggtattaaattctatgctgaagatccatgtaaacttaaagaagaaataaccagatatcagtttttcttgcaggtgaagcaagatgtccttcagggccgtctgccctgtcccgtcaacactgctgctcagctgggagcgtatgccatccagtcggagcttggagattatgacccatataaacatactgcaggatatgtatctgagtaccggtttgttcctgatcagaaggaagaacttgaagaagccatagaaaggattcataaaactctaatgtaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- U2 small nuclear RNA auxiliary factor 1-like 4 - interleukin 18 (interferon-gamma-inducing factor) - tumor necrosis factor, alpha-induced protein 8 - CNDP dipeptidase 2 (metallopeptidase M20 family)

Reviews

Be the first to write your review !

Buy EPB41L4A-erythrocyte membrane protein band 4.1 like 4A Gene now