DDIT3-DNA-damage-inducible transcript 3 Gene View larger

DDIT3-DNA-damage-inducible transcript 3 Gene

PTXBC003637

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDIT3-DNA-damage-inducible transcript 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DDIT3-DNA-damage-inducible transcript 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003637
Product type: DNA & cDNA
Ncbi symbol: DDIT3
Origin species: Human
Product name: DDIT3-DNA-damage-inducible transcript 3 Gene
Size: 2ug
Accessions: BC003637
Gene id: 1649
Gene description: DNA-damage-inducible transcript 3
Synonyms: CEBPZ; CHOP; CHOP-10; CHOP10; GADD153; DNA damage-inducible transcript 3 protein; C/EBP zeta; CCAAT/enhancer-binding protein homologous protein; DDIT-3; c/EBP-homologous protein 10; growth arrest and DNA damage-inducible protein GADD153; DNA damage inducible transcript 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctgagtcattgcctttctcctttgggacactgtccagctgggagctggaagcctggtatgaggacctgcaagaggtcctgtcttcagatgaaaatgggggtacctatgtttcacctcctggaaatgaagaggaagaatcaaaaatcttcaccactcttgaccctgcttctctggcttggctgactgaggaggagccagaaccagcagaggtcacaagcacctcccagagccctcactctccagattccagtcagagctccctggctcaggaggaagaggaggaagaccaagggagaaccaggaaacggaaacagagtggtcattccccagcccgggctggaaagcagcgcatgaaggagaaagaacaggagaatgaaaggaaagtggcacagctagctgaagagaatgaacggctcaagcaggaaatcgagcgcctgaccagggaagtagaggcgactcgccgagctctgattgaccgaatggtgaatctgcaccaagcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB3B, member RAS oncogene family
- RAB14, member RAS oncogene family
- hypothetical protein LOC403312
- RAB8A, member RAS oncogene family

Reviews

Buy DDIT3-DNA-damage-inducible transcript 3 Gene now

Add to cart