Cart 9 Product Products 1 363,88 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x DMC1-DMC1...121,50 €
No products
To be determined Shipping
1 363,88 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 363,88 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 363,88 €
Data sheet of RPL18-ribosomal protein L18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL18-ribosomal protein L18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021743 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL18 |
| Origin species: | Human |
| Product name: | RPL18-ribosomal protein L18 Gene |
| Size: | 2ug |
| Accessions: | BC021743 |
| Gene id: | 6141 |
| Gene description: | ribosomal protein L18 |
| Synonyms: | L18; 60S ribosomal protein L18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagtggacatccgccataacaaggaccgaaaggttcggcgcaaggagcccaagagccaggatatctacctgaggctgttggtcaagttatacaggtttctggccagaagaaccaactccacattcaaccaggttgtgttgaagaggttgtttatgagtcgcaccaaccggccgcctctgtgcctttcccggatgatccggaagatgaagcttcctggccgggaaaacaagacggccgtggttgtggggaccataactgatgatgtgcgggttcaggaggtacccaaactgaaggtatgtgcactgcgcgtgaccagccgggcccgcagccgcatcctcagggcagggggcaagatcctcactttcgaccagctggccctggactcccctaagggctgtggcactgtcctgctctccggtcctcgcaagggccgagaggtgtaccggcatttcggcaaggccccaggaaccccgcacagccacaccaaaccctacgtccgctccaagggccggaagttcgagcgtgccagaggccgacgggccagccgaggctacaaaaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L15 - placental growth factor - PDZ and LIM domain 5 - exostoses (multiple) 2 |