Cart 35 Product Products 4 947,35 € (empty)
-
1 x Cortisol...339,00 € -
-
1 x KLK10-kall...121,50 € -
-
-
-
1 x HMGN1-high...113,40 € -
1 x ZIM3-zinc...121,50 € -
-
1 x MYL6B-myos...113,40 € -
-
-
-
-
1 x STK32B-ser...121,50 € -
-
-
1 x CAMK1G-cal...121,50 € -
1 x CAPSL-calc...113,40 € -
1 x HIST1H4H-h...113,40 € -
1 x Mas1...259,07 € -
-
1 x TINAGL1-tu...121,50 € -
1 x TSHR-thyro...113,40 € -
-
-
1 x TMEM103-tr...121,50 € -
1 x OR2L13-olf...121,50 € -
-
1 x C6orf218-c...113,40 € -
1 x Olfactory...259,07 € -
-
-
1 x PRR10-prol...113,40 € -
No products
To be determined Shipping
4 947,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 947,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 947,35 €
Data sheet of SCG5-secretogranin V (7B2 protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCG5-secretogranin V (7B2 protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005349 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCG5 |
| Origin species: | Human |
| Product name: | SCG5-secretogranin V (7B2 protein) Gene |
| Size: | 2ug |
| Accessions: | BC005349 |
| Gene id: | 6447 |
| Gene description: | secretogranin V (7B2 protein) |
| Synonyms: | 7B2; P7B2; SGNE1; SgV; neuroendocrine protein 7B2; pituitary polypeptide; prohormone convertase chaperone; secretogranin-5; secretory granule endocrine protein I; secretory granule, neuroendocrine protein 1 (7B2 protein); secretogranin V |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctccaggatggtctctaccatgctatctggcctactgttttggctggcatctggatggactccagcatttgcttacagcccccggacccctgaccgggtctcagaagcagatatccagaggctgcttcatggtgttatggagcaattgggcattgccaggccccgagtggaatatccagctcaccaggccatgaatcttgtgggcccccagagcattgaaggtggagctcatgaaggacttcagcatttgggtccttttggcaacatccccaacatcgtggcagagttgactggagacaacattcctaaggactttagtgaggatcaggggtacccagaccctccaaatccctgtcctgttggaaaaacagcagatgatggatgtctagaaaacacccctgacactgcagagttcagtcgagagttccagttgcaccagcatctctctgatccggaacatgactatccaggcttgggcaagtggaacaagaaactcctttacgagaagatgaagggaggagagagacgaaagcggaggagtgtcaatccatatctacaaggacagagactggataatgttgttgcaaagaagtctgtcccccatttttcagatgaggataaggatccagagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras homolog enriched in brain - dedicator of cytokinesis 10 - chloride channel CLIC-like 1 - RNA binding motif protein 28 |