Cart 9 Product Products 2 444,10 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
No products
To be determined Shipping
2 444,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 444,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 444,10 €
View larger 
Data sheet of GCA-grancalcin, EF-hand calcium binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GCA-grancalcin, EF-hand calcium binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005214 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GCA |
| Origin species: | Human |
| Product name: | GCA-grancalcin, EF-hand calcium binding protein Gene |
| Size: | 2ug |
| Accessions: | BC005214 |
| Gene id: | 25801 |
| Gene description: | grancalcin, EF-hand calcium binding protein |
| Synonyms: | GCL; grancalcin; grancalcin, EF-hand calcium-binding protein; grancalcin, penta-EF-hand protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctacccgggatacggaggagggtttggaaattttagcattcaggtgccaggaatgcagatgggacagccagtgccagaaacaggcccagctatactcctcgatggatactctgggccagcatattcagacacttattcctcagctggtgactccgtgtatacttacttcagtgctgttgctggacaggatggtgaagtggatgctgaagaacttcagagatgtttgacacagtctggaattaatggaacttactctcccttcagtttggaaacctgcagaattatgattgccatgttggatagagatcacacaggaaaaatgggatttaatgcattcaaagagctatgggcagctcttaatgcctggaaggaaaacttcatgactgttgatcaagatggaagtggcacagtagaacatcatgagttgcgtcaagccattggtcttatgggttataggttgagtcctcaaacattaactacaattgttaaacgttatagcaagaatggcagaattttctttgatgattatgttgcttgctgtgtgaagcttcgagcattgacagatttctttaggaaaagagaccacttgcaacaagggtctgcgaatttcatatatgacgattttttgcagggcactatggcaatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase B (cyclophilin B) - F-box and WD repeat domain containing 11 - lymphocyte-specific protein tyrosine kinase - spermidine/spermine N1-acetyltransferase 1 |