Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP3R2-protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform Gene
PTXBC030595
New product
Data sheet of PPP3R2-protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP3R2-protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030595 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP3R2 |
| Origin species: | Human |
| Product name: | PPP3R2-protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform Gene |
| Size: | 2ug |
| Accessions: | BC030595 |
| Gene id: | 5535 |
| Gene description: | protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform |
| Synonyms: | PPP3RL; calcineurin subunit B type 2; CBLP; CNBII; calcineurin B, type II (19kDa); calcineurin B-like protein; calcineurin BII; protein phosphatase 2B regulatory subunit 2; protein phosphatase 3 (formerly 2B), regulatory subunit B (19kD), beta isoform (calcineurin B, type II); protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, beta isoform (calcineurin B, type II); protein phosphatase 3 (formerly 2B), regulatory subunit B, beta isoform; protein phosphatase 3 regulatory subunit B beta isoform; protein phosphatase 3 regulatory subunit B, beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccacaatgggaaacgaggccagttacccggcggagatgtgctcccactttgacaatgatgaaattaaaaggctgggcaggaggtttaagaagttggacttggacaaatcagggtctctgagcgtggaggagttcatgtccctgccggagctgcgccacaacccgttggtgcggcgagtgatcgacgtcttcgacaccgacggtgatggagaagtggacttcaaggaattcatcctggggacctcccagttcagcgtcaagggcgacgaggagcagaagttgaggtttgcgttcagcatttacgacatggataaagatggctacatttccaacggggagctcttccaggtgctgaagatgatggtgggcaacaacctgacggactggcagctccagcagctggtcgacaaaaccatcatcatcctggacaaggatggcgatgggaagatatcctttgaggaattcagtgctgtggtcagagacctggagatccacaagaagctggtcctcatcgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 - dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) - guanine nucleotide binding protein (G protein), beta polypeptide 1-like |