Cart 5 Product Products 573,74 € (empty)
-
1 x C11orf67-c...113,40 € -
1 x MDP-1-magn...113,40 € -
1 x PTS-6-pyru...113,40 € -
1 x PARP6-poly...121,50 € -
No products
To be determined Shipping
573,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 573,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 573,74 €
Data sheet of MRPL32-mitochondrial ribosomal protein L32 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL32-mitochondrial ribosomal protein L32 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013147 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL32 |
| Origin species: | Human |
| Product name: | MRPL32-mitochondrial ribosomal protein L32 Gene |
| Size: | 2ug |
| Accessions: | BC013147 |
| Gene id: | 64983 |
| Gene description: | mitochondrial ribosomal protein L32 |
| Synonyms: | HSPC283; L32mt; MRP-L32; bMRP-59b; 39S ribosomal protein L32, mitochondrial; mitochondrial ribosomal protein L32 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctggccatgctggtcttggtggtttcgccgtggtctgcggcccggggagtgcttcgaaactactgggagcgactgctacggaagcttccgcagagccggccgggctttcccagtcctccgtggggaccagcattagcagtacagggcccagccatgtttacagagccagcaaatgataccagtggaagtaaagagaattccagccttttggacagtatcttttggatggcagctcccaaaaatagacgcaccattgaagttaaccggtgtaggagaagaaatccgcagaagcttattaaagttaagaacaacatagacgtttgtcctgaatgtggtcacctgaaacagaaacatgtcctttgtgcctactgctatgaaaaggtgtgcaaggagactgcagaaatcagacgacagatagggaagcaagaagggggcccttttaaggctcccaccatagagactgtggtgctgtacacaggagagacaccgtctgaacaagatcagggcaagaggatcattgaacgagacagaaagcgaccatcctggttcacccagaattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S25 - mitochondrial ribosomal protein L13 - chromosome 6 open reading frame 64 - chromosome 16 open reading frame 5 |