Cart 2 Product Products 216,18 € (empty)
-
1 x C5orf48-ch...113,40 € -
No products
To be determined Shipping
216,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 216,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 216,18 €
Data sheet of MRPL49-mitochondrial ribosomal protein L49 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL49-mitochondrial ribosomal protein L49 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004378 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL49 |
| Origin species: | Human |
| Product name: | MRPL49-mitochondrial ribosomal protein L49 Gene |
| Size: | 2ug |
| Accessions: | BC004378 |
| Gene id: | 740 |
| Gene description: | mitochondrial ribosomal protein L49 |
| Synonyms: | C11orf4; L49mt; MRP-L49; NOF1; 39S ribosomal protein L49, mitochondrial; neighbor of FAU; next to FAU; mitochondrial ribosomal protein L49 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagctaccatgttccgggctacgctgcggggatggagaaccggtgtccagcggggctgcgggctacggctgttgagccagacccagggccctccagattaccccaggtttgtggagtctgtggatgaatatcagtttgtggagcgcctgttaccggctaccaggatcccagatcccccaaagcatgaacattatcctacccctagtggctggcagcctcccagagaccccccacccaacctgccttactttgtacgacgctctcggatgcacaacatccccgtctacaaggacatcacgcatggcaaccggcagatgactgtgatccggaaagtggaaggggacatctgggccctgcagaaagacgtggaagattttctgagcccgctgctggggaagacacctgtcacccaggtcaatgaggtgacaggtaccctacggatcaagggctactttgaccaggagcttaaagcctggctcttggagaaaggcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L32 - mitochondrial ribosomal protein S25 - mitochondrial ribosomal protein L13 - chromosome 6 open reading frame 64 |