C20orf141-chromosome 20 open reading frame 141 Gene View larger

C20orf141-chromosome 20 open reading frame 141 Gene

PTXBC014591

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf141-chromosome 20 open reading frame 141 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf141-chromosome 20 open reading frame 141 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014591
Product type: DNA & cDNA
Ncbi symbol: C20orf141
Origin species: Human
Product name: C20orf141-chromosome 20 open reading frame 141 Gene
Size: 2ug
Accessions: BC014591
Gene id: 128653
Gene description: chromosome 20 open reading frame 141
Synonyms: uncharacterized protein C20orf141; dJ860F19.4; chromosome 20 open reading frame 141
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccggctctgcttacccagacccgaagcacgtgaggatccgatcccagttcctccaaggggcctgggtgctggggaggggtcaggtagtccagtgcgtccacctgtatccacctggggccctagctgggcccagctcctggacagtgtcctatggctgggggcactaggactgacaatccaggcagtcttttccaccactggcccagccctgctgctgcttctggtcagcttcctcacctttgacctgctccataggcccgcaggtcacactctgccacagcgcaaacttctcaccaggggccagagtcagggggccggtgaaggtcctggacagcaggaggctctactcctgcaaatgggtacagtctcaggacaacttagcctccaggacgcactgctgctgctgctcatggggctgggcccgctcctgagagcctgtggcatgcccttgaccctgcttggcctggctttctgcctccatccttgggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coatomer protein complex, subunit zeta 1
- zinc finger, CCHC domain containing 13
- plasma membrane proteolipid (plasmolipin)
- chromosome 14 open reading frame 139

Reviews

Buy C20orf141-chromosome 20 open reading frame 141 Gene now

Add to cart