Cart 7 Product Products 1 413,91 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 € -
-
-
1 x Free Estriol399,00 € -
1 x SNRPE-smal...113,40 € -
1 x BUB3-buddi...121,50 €
No products
To be determined Shipping
1 413,91 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 413,91 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 413,91 €
View larger 
Data sheet of DHRS11-dehydrogenase/reductase (SDR family) member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHRS11-dehydrogenase/reductase (SDR family) member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002731 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHRS11 |
| Origin species: | Human |
| Product name: | DHRS11-dehydrogenase/reductase (SDR family) member 11 Gene |
| Size: | 2ug |
| Accessions: | BC002731 |
| Gene id: | 79154 |
| Gene description: | dehydrogenase/reductase (SDR family) member 11 |
| Synonyms: | ARPG836; SDR24C1; spDHRS11; dehydrogenase/reductase SDR family member 11; dehydrogenase/reductase (SDR family) member 11; inactive dehydrogenase/reductase isoform; short-chain dehydrogenase/reductase family 24C member 1; dehydrogenase/reductase 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttctcagctatccgttctcagcacagcggtgtagacatctgcatcaacaatgctggcttggcccggcctgacaccctgctctcaggcagcaccagtggttggaaggacatgttcaatgtgaacgtgctggccctcagcatctgcacacgggaagcctaccagtccatgaaggagcggaatgtggacgatgggcacatcattaacatcaatagcatgtctggccaccgagtgttacccctgtctgtgacccacttctatagtgccaccaagtatgccgtcactgcgctgacagagggactgaggcaagagcttcgggaggcccagacccacatccgagccacgtgcatctctccaggtgtggtggagacacaattcgccttcaaactccacgacaaggaccctgagaaggcagctgccacctatgagcaaatgaagtgtctcaaacccgaggatgtggccgaggctgttatctacgtcctcagcacccccgcacacatccagattggagacatccagatgaggcccacggagcaggtgacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribonuclease, RNase A family, 11 (non-active) - family with sequence similarity 128, member B - family with sequence similarity 174, member A - aldehyde dehydrogenase 2 family (mitochondrial) |