Cart 1 Product Products 113,40 € (empty)
-
1 x APOBEC3C-a...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
PTPN20B-protein tyrosine phosphatase, non-receptor type 20B Gene
PTXBC036539
New product
Data sheet of PTPN20B-protein tyrosine phosphatase, non-receptor type 20B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN20B-protein tyrosine phosphatase, non-receptor type 20B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036539 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN20B |
| Origin species: | Human |
| Product name: | PTPN20B-protein tyrosine phosphatase, non-receptor type 20B Gene |
| Size: | 2ug |
| Accessions: | BC036539 |
| Gene id: | 26095 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 20B |
| Synonyms: | PTPN20B; CT126; PTPN20A; bA142I17.1; bA42B19.1; tyrosine-protein phosphatase non-receptor type 20; protein tyrosine phosphatase, non-receptor type 20A; protein tyrosine phosphatase, non-receptor type 20B; protein tyrosine phosphatase, non-receptor type 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttcacctagggactttagagcagagcctgtaaacgattatgagggaaatgactctgaagcagaagacttgaatttcagggagactttgccttcatcaagtcaggaaaacacacctagatcaaaggtttttgaaaataaagttaattcagagaaggtaaaactttctcttcggaatttcccacataatgattatgaggatgtttttgaagagccttcagaaagtggcagtgatcccagcatgtggacagccagaggccccttcagaagagacaggtggagcagtgaggatgaggaggctgcagggccatcacaggctctctcccctctactttctggtacgcgcaaaattgtttctgaaggagaactagatcagttggctcagattcggccattaatattcaattttcatgagcagacagccatcaaggattgtttgaaaatccttgaagaaaaaaacagcagcgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - estrogen receptor binding site associated, antigen, 9 - peptidylprolyl cis/trans isomerase, NIMA-interacting 1 - ADP-ribosylation factor GTPase activating protein 3 - TEL2, telomere maintenance 2, homolog (S. cerevisiae) |