> >>CCK-cholecystokinin Gene
CCK-cholecystokinin Gene View larger

CCK-cholecystokinin Gene

PTXBC008283

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of CCK-cholecystokinin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCK-cholecystokinin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008283
Product type: DNA & cDNA
Ncbi symbol: CCK
Origin species: Human
Product name: CCK-cholecystokinin Gene
Size: 2ug
Accessions: BC008283
Gene id: 885
Gene description: cholecystokinin
Synonyms: cholecystokinin triacontatriapeptide; prepro-cholecystokinin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacagcggcgtgtgcctgtgcgtgctgatggcggtactggcggctggcgccctgacgcagccggtgcctcccgcagatcccgcgggctccgggctgcagcgggcagaggaggcgccccgtaggcagctgagggtatcgcagagaacggatggcgagtcccgagcgcacctgggcgccctgctggcaagatacatccagcaggcccggaaagctccttctggacgaatgtccatcgttaagaacctgcagaacctggaccccagccacaggataagtgaccgggactacatgggctggatggattttggccgtcgcagtgccgaggagtatgagtacccctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 15
- myotubularin 1
- laminin, gamma 1 (formerly LAMB2)
- cytochrome c oxidase subunit VIIc

Reviews

Buy CCK-cholecystokinin Gene now

Add to cart