DAP-death-associated protein Gene

View larger

DAP-death-associated protein Gene

Reference: PTXBC002726

Condition: New product

Print

Data sheet of DAP-death-associated protein Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about DAP-death-associated protein Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC002726
Product type:	DNA & cDNA
Ncbi symbol:	DAP
Origin species:	Human
Product name:	DAP-death-associated protein Gene
Size:	2ug
Accessions:	BC002726
Gene id:	1611
Gene description:	death-associated protein
Synonyms:	DAP-1; death-associated protein 1; death associated protein
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcttcgcctcccgaagggaaactagagactaaagctggacacccgcccgccgtgaaagctggtggaatgcgaattgtgcagaaacacccacatacaggagacaccaaagaagagaaagacaaggatgaccaggaatgggaaagccccagtccacctaaacccactgtgttcatctctggggtcatcgcccggggtgacaaagatttccccccggcggctgcgcaggtggctcaccagaagccgcatgcctccatggacaagcatccttccccaagaacccagcacatccagcagccacgcaagtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- hypoxia up-regulated 1 - TP53RK binding protein - zinc finger protein 92 - AP2 associated kinase 1

Reviews

Be the first to write your review !

Buy DAP-death-associated protein Gene now