No products
Prices are tax excluded
PTXBC004219
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC004219 |
Product type: | DNA & cDNA |
Ncbi symbol: | AGPAT3 |
Origin species: | Human |
Product name: | AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene |
Size: | 2ug |
Accessions: | BC004219 |
Gene id: | 56894 |
Gene description: | 1-acylglycerol-3-phosphate O-acyltransferase 3 |
Synonyms: | LPAAT-GAMMA1; LPAAT3; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma; 1-AGP acyltransferase 3; 1-AGPAT 3; lysophosphatidic acid acyltransferase gamma; lysophosphatidic acid acyltransferase-gamma1; 1-acylglycerol-3-phosphate O-acyltransferase 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggtctcctgcccatcttcccaaggatgccattgctgtcttcatcgtcttcccccgtgtgagacactggttgtctggtactcggcgacagtgtaccagacgcgcaccctatgtgaggtgctttaaggtccctgtcctcaggaagcgcagtctggtggaagagatgagcgctgaacaaatcactaaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - dehydrogenase/reductase (SDR family) member 11 - ribonuclease, RNase A family, 11 (non-active) - family with sequence similarity 128, member B - family with sequence similarity 174, member A |