AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene View larger

AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene

PTXBC004219

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004219
Product type: DNA & cDNA
Ncbi symbol: AGPAT3
Origin species: Human
Product name: AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene
Size: 2ug
Accessions: BC004219
Gene id: 56894
Gene description: 1-acylglycerol-3-phosphate O-acyltransferase 3
Synonyms: LPAAT-GAMMA1; LPAAT3; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma; 1-AGP acyltransferase 3; 1-AGPAT 3; lysophosphatidic acid acyltransferase gamma; lysophosphatidic acid acyltransferase-gamma1; 1-acylglycerol-3-phosphate O-acyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtctcctgcccatcttcccaaggatgccattgctgtcttcatcgtcttcccccgtgtgagacactggttgtctggtactcggcgacagtgtaccagacgcgcaccctatgtgaggtgctttaaggtccctgtcctcaggaagcgcagtctggtggaagagatgagcgctgaacaaatcactaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dehydrogenase/reductase (SDR family) member 11
- ribonuclease, RNase A family, 11 (non-active)
- family with sequence similarity 128, member B
- family with sequence similarity 174, member A

Reviews

Buy AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene now

Add to cart