CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene View larger

CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene

PTXBC006182

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006182
Product type: DNA & cDNA
Ncbi symbol: CALM3
Origin species: Human
Product name: CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene
Size: 2ug
Accessions: BC006182
Gene id: 808
Gene description: calmodulin 3 (phosphorylase kinase, delta)
Synonyms: CaM; CaMIII; HEL-S-72; PHKD; PHKD3; calmodulin; epididymis secretory protein Li 72; phosphorylase kinase subunit delta; prepro-calmodulin 3; calmodulin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctttgacaaggatggagatggcactatcaccaccaaggagttggggacagtgatgagatccctgggacagaaccccactgaagcagagctgcaggatatgatcaatgaggtggatgcagatgggaacgggaccattgacttcccggagttcctgaccatgatggccagaaagatgaaggacacagacagtgaggaggagatccgagaggcgttccgtgtctttgacaaggatgggaatggctacatcagcgccgcagagctgcgtcacgtaatgacgaacctgggggagaagctgaccgatgagtctctctccatgcccctcatctcttccttttgccctcgcctcttccatccatgtcttccaaggcctgatgcattcataagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphodiesterase 4D interacting protein
- nucleolar protein family 6 (RNA-associated)
- chromodomain helicase DNA binding protein 2
- cytochrome c oxidase subunit IV isoform 1

Reviews

Buy CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene now

Add to cart