Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PLEKHJ1-pleckstrin homology domain containing, family J member 1 Gene
PTXBC003084
New product
Data sheet of PLEKHJ1-pleckstrin homology domain containing, family J member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLEKHJ1-pleckstrin homology domain containing, family J member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003084 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLEKHJ1 |
| Origin species: | Human |
| Product name: | PLEKHJ1-pleckstrin homology domain containing, family J member 1 Gene |
| Size: | 2ug |
| Accessions: | BC003084 |
| Gene id: | 55111 |
| Gene description: | pleckstrin homology domain containing, family J member 1 |
| Synonyms: | GNRPX; pleckstrin homology domain-containing family J member 1; PH domain-containing family J member 1; guanine nucleotide releasing protein x; pleckstrin homology domain containing J1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggtacaacgagaaggagctgcaggctctgtcccggcagccggccgagatggcggccgagctgggcatgaggggccccaagaagggcagcgtgctgaagcggcggctggtgaagctggtggtgaatttcctcttctactttcggacagacgaggccgagcccgtcggagccctgctgctggagcgctgcagagtcgtccgggaagagcccggcaccttctccatcagcttcattgaggaccctgagaggaagtatcactttgagtgcagcagcgaggagcagtgtcaggagtggatggaggctctgcgtcgggccagctacgagttcatgcggagaagcctcatcttctacaggaacgaaatccggaaggtgacgggcaaggaccccctggaacagttcggcatatccgaggaggccaggttccagctgagtggcttgcaggcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) - regulatory factor X, 4 (influences HLA class II expression) - chaperone, ABC1 activity of bc1 complex homolog (S. pombe) - regulatory factor X, 4 (influences HLA class II expression) |