Cart 7 Product Products 792,97 € (empty)
-
-
-
1 x CRYGD-crys...113,40 € -
1 x COQ9-coenz...121,50 € -
1 x SFTPD-surf...121,50 € -
-
No products
To be determined Shipping
792,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 792,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 792,97 €
Data sheet of CRIP1-cysteine-rich protein 1 (intestinal) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRIP1-cysteine-rich protein 1 (intestinal) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002738 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRIP1 |
| Origin species: | Human |
| Product name: | CRIP1-cysteine-rich protein 1 (intestinal) Gene |
| Size: | 2ug |
| Accessions: | BC002738 |
| Gene id: | 1396 |
| Gene description: | cysteine-rich protein 1 (intestinal) |
| Synonyms: | CRHP; CRIP; CRP-1; CRP1; cysteine-rich protein 1; cysteine-rich heart protein; cysteine-rich intestinal protein; cysteine-rich protein 1 (intestinal); cysteine rich protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccaagtgtcccaagtgcaacaaggaggtgtacttcgccgagagggtgacctctctgggcaaggactggcatcggccctgcctgaagtgcgagaaatgtgggaagacgctgacctctgggggccacgctgagcacgaaggcaaaccctactgcaaccacccctgctacgcagccatgtttgggcctaaaggctttgggcggggcggagccgagagccacactttcaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 64 - chromosome 9 open reading frame 16 - chromosome 1 open reading frame 91 - chromosome 2 open reading frame 40 |