SAP18-Sin3A-associated protein, 18kDa Gene

View larger

SAP18-Sin3A-associated protein, 18kDa Gene

Reference: PTXBC030836

Condition: New product

Print

Data sheet of SAP18-Sin3A-associated protein, 18kDa Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SAP18-Sin3A-associated protein, 18kDa Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC030836
Product type:	DNA & cDNA
Ncbi symbol:	SAP18
Origin species:	Human
Product name:	SAP18-Sin3A-associated protein, 18kDa Gene
Size:	2ug
Accessions:	BC030836
Gene id:	10284
Gene description:	Sin3A-associated protein, 18kDa
Synonyms:	histone deacetlyase complex subunit SAP18; histone deacetylase complex subunit SAP18; 2HOR0202; SAP18P; 18 kDa Sin3-associated polypeptide; Sin3A-associated protein, 18kDa; cell growth inhibiting protein 38; cell growth-inhibiting gene 38 protein; sin3-associated polypeptide, 18 kDa; sin3-associated polypeptide, p18; Sin3A associated protein 18
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcggtggagtcgcgcgttacccaggaggaaattaagaaggagccagagaaaccgatcgaccgcgagaagacatgcccactgttgctacgggtcttcaccaccaataacggccgccaccaccgaatggacgagttctcccggggaaatgtaccgtccagcgagttgcagatctacacttggatggatgcaactttgaaagaactgacaagcttagtaaaagaagtctacccagaagctagaaagaagggcactcacttcaattttgcaatcgtttttacagatgttaaaagacctggctatcgagttaaggaaattggcagcaccatgtctggcagaaaggggactgatgattccatgaccctgcagtcgcagaagttccagataggagattacttggacatagcaattacccctccaaatcgggcaccacctacttcagggcgcatgagaccatattaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- NECAP endocytosis associated 1 - tripartite motif-containing 41 - osteoclast stimulating factor 1 - KH homology domain containing 1

Reviews

Be the first to write your review !

Buy SAP18-Sin3A-associated protein, 18kDa Gene now