Cart 18 Product Products 2 854,12 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
No products
To be determined Shipping
2 854,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 854,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 854,12 €
View larger 
ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene
PTXBC032893
New product
Data sheet of ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032893 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ISCA2 |
| Origin species: | Human |
| Product name: | ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC032893 |
| Gene id: | 122961 |
| Gene description: | iron-sulfur cluster assembly 2 homolog (S. cerevisiae) |
| Synonyms: | HBLD1; ISA2; MMDS4; c14_5557; iron-sulfur cluster assembly 2 homolog, mitochondrial; HESB-like domain-containing protein 1; iron-sulfur cluster assembly 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccgcctgggggtcgtccctaacggccgcgacgcagagagcggtcactccctggccgaggggcaggctcctcacggcctccctgggaccccaggcgcgtcgggaggcgtcgtcctccagccccgaggccggcgaagggcagatctgcctcacagacagttgcgtccagaggcttttggaaatcaccgaagggtcagaattcctcaggctgcaagtggagggaggtggatgctccggattccaatacaaattttcactggatacagttatcaaccccgacgacagggtatttgaacagggtggggcaagagtggtggttgactctgatagcttggccttcgtgaaaggggcccaggtggacttcagccaagaactgatccgaagctcatttcaagtgttgaacaatcctcaagcacagcaaggctgctcctgtgggtcatctttctctatcaaactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 6 interacting protein 1 - membrane-bound transcription factor peptidase, site 1 - ATP-binding cassette, sub-family B (MDR/TAP), member 6 - budding uninhibited by benzimidazoles 1 homolog (yeast) |