SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

View larger

SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

Reference: PTXBC004481

Condition: New product

Print

Data sheet of SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC004481
Product type:	DNA & cDNA
Ncbi symbol:	SCGB1A1
Origin species:	Human
Product name:	SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene
Size:	2ug
Accessions:	BC004481
Gene id:	7356
Gene description:	secretoglobin, family 1A, member 1 (uteroglobin)
Synonyms:	CC10; CC16; CCPBP; CCSP; UGB; UP-1; UP1; uteroglobin; blastokinin; clara cell phospholipid-binding protein; clara cells 10 kDa secretory protein; secretoglobin, family 1A, member 1 (uteroglobin); urinary protein 1; urine protein 1; secretoglobin family 1A member 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgaaactcgctgtcaccctcaccctggtcacactggctctctgctgcagctccgcttctgcagagatctgcccgagctttcagcgtgtcatcgaaaccctcctcatggacacaccctccagttatgaggctgccatggaacttttcagccctgatcaagacatgagggaggcaggggctcagctgaagaagctggtggacaccctcccccaaaagcccagagaaagcatcattaagctcatggaaaaaatagcccaaagctcactgtgtaattag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- polymerase (DNA directed), epsilon 3 (p17 subunit) - CKLF-like MARVEL transmembrane domain containing 5 - CKLF-like MARVEL transmembrane domain containing 6 - DnaJ (Hsp40) homolog, subfamily C, member 5 beta

Reviews

Be the first to write your review !

Buy SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene now