Cart 1 Product Products 109,47 € (empty)
No products
To be determined Shipping
109,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 109,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 109,47 €
Data sheet of HDAC6-histone deacetylase 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HDAC6-histone deacetylase 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005872 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HDAC6 |
| Origin species: | Human |
| Product name: | HDAC6-histone deacetylase 6 Gene |
| Size: | 2ug |
| Accessions: | BC005872 |
| Gene id: | 10013 |
| Gene description: | histone deacetylase 6 |
| Synonyms: | CPBHM; HD6; JM21; PPP1R90; histone deacetylase 6; protein phosphatase 1, regulatory subunit 90 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacctcaaccggccaggattccaccacaaccaggcagcgaagaagtaggcagaacccccagtcgccccctcaggactccagtgtcacttcgaagcgaaatattaaaaagggagccgttccccgctctatccccaatctagcggaggtaaagaagaaaggcaaaatgaagaagctcggccaagcaatggaagaagacctaatcgtgggactgcaagggatggatctgaaccttgaggctgaagcactggctggcactggcttggtgttggatgagcagttaaatgaattccattgcctctgggatgacagcttcccggaaggccctgagcggctccatgccatcaaggagcaactgatccaggagggcctcctagatcgctgcgtgtcctttcaggcccggtttgctgaaaaggaagagctgatgttggttcacaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L36 - ribosomal protein S16 - ribosomal protein S13 - ribosomal protein S10 |