PTXBC002802
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC002802 |
Product type: | DNA & cDNA |
Ncbi symbol: | SUPT4H1 |
Origin species: | Human |
Product name: | SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC002802 |
Gene id: | 6827 |
Gene description: | suppressor of Ty 4 homolog 1 (S. cerevisiae) |
Synonyms: | SPT4; SPT4H; SUPT4H; Supt4a; transcription elongation factor SPT4; DRB sensitivity-inducing factor 14 kDa subunit; DSIF p14; small hSpt4 subunit; suppressor of Ty 4 homolog 1; SPT4 homolog, DSIF elongation factor subunit |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggccctggagacggtgccgaaggacctgcggcatctgcgggcctgtttgctgtgttcgctggtcaagactatagaccagtttgaatatgatggttgtgacaattgtgatgcatatctacaaatgaagggtaaccgagagatggtatatgactgcactagctcttcctttgatggaatcattgcgatgatgagtccagaggacagctgggtctccaagtggcagcgagtcagtaactttaagccaggtgtatatgcggtgtcagtcactggtcgcctgccccaaggaatcgtgcgggagctgaaaagtcgaggagtggcctacaaatccagagacacagctataaagacctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - ubiquitin-conjugating enzyme E2D 4 (putative) - nucleolar protein 5A (56kDa with KKE/D repeat) - cell division cycle 20 homolog (S. cerevisiae) - receptor-interacting serine-threonine kinase 2 |