Cart 16 Product Products 1 890,20 € (empty)
-
-
1 x PARP11-pol...113,40 € -
1 x MID1IP1-MI...113,40 € -
1 x CCDC90B-co...113,40 € -
1 x RAB3IL1-RA...121,50 € -
1 x FIBP-fibro...121,50 € -
1 x VHLL-von...113,40 € -
-
1 x TYROBP-TYR...113,40 € -
1 x UBE2L6-ubi...113,40 € -
1 x NCF1-neutr...121,50 € -
1 x KLK13-kall...121,50 € -
1 x NMUR2-neur...121,50 € -
1 x TAT-tyrosi...121,50 € -
-
1 x LYPLA2-lys...113,40 €
No products
To be determined Shipping
1 890,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 890,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 890,20 €
View larger 
SLC22A6-solute carrier family 22 (organic anion transporter), member 6 Gene
PTXBC033682
New product
Data sheet of SLC22A6-solute carrier family 22 (organic anion transporter), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A6-solute carrier family 22 (organic anion transporter), member 6 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC033682 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A6 |
| Origin species: | Human |
| Product name: | SLC22A6-solute carrier family 22 (organic anion transporter), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC033682 |
| Gene id: | 9356 |
| Gene description: | solute carrier family 22 (organic anion transporter), member 6 |
| Synonyms: | HOAT1; PAHT; ROAT1; solute carrier family 22 member 6; PAH transporter; hPAHT; hROAT1; organic anion transporter 1; para-aminohippurate transporter; renal organic anion transporter 1; solute carrier family 22 (organic anion transporter), member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctttaatgacctcctgcagcaggtggggggtgtcggccgcttccagcagatccaggtcaccctggtggtcctccccctgctcctgatggcttctcacaacaccctgcagaacttcactgctgccatccctacccaccactgccgcccgcctgccgatgccaacctcagcaagaacggggggctggaggtctggctgccccgggacaggcaggggcagcctgagtcctgcctccgcttcacctccccgcagtggggactgccctttctcaatggcacagaagccaatggcacaggggccacagagccctgcaccgatggctggatctatgacaacagcaccttcccatctaccatcgtgactgagtgggaccttgtgtgctctcacagggccctacgccagctggcccagtccttgtacatggtgggggtgctgctcggagccatggtgttcggctaccttgcagacaggctaggccgccggaaggtactcatcttgaactacctgcagacagctgtgtcagggacctgcgcagccttcgcacccaacttccccatctactgcgccttccggctcctctcgggcatggctctggctggcatctccctcaactgcatgacactgaatgtggagtggatgcccattcacacacgggcctgcgtgggcaccttgattggctatgtctacagcctgggccagttcctcctggctggtgtggcctacgctgtgccccactggcgccacctgcagctactggtctctgcgcctttttttgccttcttcatctactcctggttcttcattgagtcggcccgctggcactcctcctccgggaggctggacctcaccctgagggccctgcagagagtcgcccggatcaatgggaagcgggaagaaggagccaaattgagtatggaggtactccgggccagtctgcagaaggagctgaccatgggcaaaggccaggcatcggccatggagctgctgcgctgccccaccctccgccacctcttcctctgcctctccatgctgtggtttgccactagctttgcatactatgggctggtcatggacctgcagggctttggagtcagcatctacctaatccaggtgatctttggtgctgtggacctgcctgccaagcttgtgggcttccttgtcatcaactccctgggtcgccggcctgcccagatggctgcactgctgctggcaggcatctgcatcctgctcaatggggtgataccccaggaccagtccattgtccgaacctctcttgctgtgctggggaagggttgtctggctgcctccttcaactgcatcttcctgtatactggggaactgtatcccacaatgatccggcagacaggcatgggaatgggcagcaccatggcccgagtgggcagcatcgtgagcccactggtgagcatgactgccgagctctacccctccatgcctctcttcatctacggtgctgttcctgtggccgccagcgctgtcactgtcctcctgccagagaccctgggccagccactgccagacacggtgcaggacctggagagcaggaaagggaaacagacgcgacagcaacaagagcaccagaagtatatggtcccactgcaggcctcagcacaagagaagaatggactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) - RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 - matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) |