Cart 4 Product Products 477,90 € (empty)
-
1 x ANKRD44-an...121,50 € -
1 x MOBP-myeli...113,40 € -
1 x CYTIP-cyto...121,50 € -
1 x C19orf47-c...121,50 €
No products
To be determined Shipping
477,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 477,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 477,90 €
View larger 
CYP1B1-cytochrome P450, family 1, subfamily B, polypeptide 1 Gene
PTXBC012049
New product
Data sheet of CYP1B1-cytochrome P450, family 1, subfamily B, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP1B1-cytochrome P450, family 1, subfamily B, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC012049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP1B1 |
| Origin species: | Human |
| Product name: | CYP1B1-cytochrome P450, family 1, subfamily B, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC012049 |
| Gene id: | 1545 |
| Gene description: | cytochrome P450, family 1, subfamily B, polypeptide 1 |
| Synonyms: | CP1B; CYPIB1; GLC3A; P4501B1; cytochrome P450 1B1; aryl hydrocarbon hydroxylase; cytochrome P450, family 1, subfamily B, polypeptide 1; cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile); flavoprotein-linked monooxygenase; microsomal monooxygenase; xenobiotic monooxygenase; cytochrome P450 family 1 subfamily B member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcaccagcctcagcccgaacgacccttggccgctaaacccgctgtccatccagcagaccacgctcctgctactcctgtcggtgctggccactgtgcatgtgggccagcggctgctgaggcaacggaggcggcagctccggtccgcgcccccgggcccgtttgcgtggccactgatcggaaacgcggcggcggtgggccaggcggctcacctctcgttcgctcgcctggcgcggcgctacggcgacgttttccagatccgcctgggcagctgccccatagtggtgctgaatggcgagcgcgccatccaccaggccctggtgcagcagggctcggccttcgccgaccggccggccttcgcctccttccgtgtggtgtccggcggccgcagcatggctttcggccactactcggagcactggaaggtgcagcggcgcgcagcccacagcatgatgcgcaacttcttcacgcgccagccgcgcagccgccaagtcctcgagggccacgtgctgagcgaggcgcgcgagctggtggcgctgctggtgcgcggcagcgcggacggcgccttcctcgacccgaggccgctgaccgtcgtggccgtggccaacgtcatgagtgccgtgtgtttcggctgccgctacagccacgacgaccccgagttccgtgagctgctcagccacaacgaagagttcgggcgcacggtgggcgcgggcagcctggtggacgtgatgccctggctgcagtacttccccaacccggtgcgcaccgttttccgcgaattcgagcagctcaaccgcaacttcagcaacttcatcctggacaagttcttgaggcactgcgaaagccttcggcccggggccgccccccgcgacatgatggacgcctttatcctctctgcggaaaagaaggcggccggggactcgcacggtggtggcgcgcggctggatttggagaacgtaccggccactatcactgacatcttcggcgccagccaggacaccctgtccaccgcgctgcagtggctgctcctcctcttcaccaggtatcctgatgtgcagactcgagtgcaggcagaattggatcaggtcgtggggagggaccgtctgccttgtatgggtgaccagcccaacctgccctatgtcctggccttcctttatgaagccatgcgcttctccagctttgtgcctgtcactattcctcatgccaccactgccaacacctctgtcttgggctaccacattcccaaggacactgtggtttttgtcaaccagtggtctgtgaatcatgacccagtgaagtggcctaacccggagaactttgatccagctcgattcttggacaaggatggcctcatcaacaaggacctgaccagcagagtgatgattttttcagtgggcaaaaggcggtgcattggcgaagaactttctaagatgcagctttttctcttcatctccatcctggctcaccagtgcgatttcagggccaacccaaatgagcctgcgaaaatgaatttcagttatggtctaaccattaaacccaagtcatttaaagtcaatgtcactctcagagagtccatggagctccttgatagtgctgtccaaaatttacaagccaaggaaacttgccaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 33 homolog A (S. cerevisiae) - apoptosis-inducing factor, mitochondrion-associated, 3 - leucine-rich repeats and WD repeat domain containing 1 - nucleolar complex associated 2 homolog (S. cerevisiae) |