Cart 22 Product Products 3 032,35 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x THEG-Theg...121,50 € -
1 x FETUB-fetu...121,50 € -
1 x MYBPC3...259,07 € -
1 x GBAP-gluco...121,50 € -
1 x UBE2O-ubiq...121,50 € -
1 x PACRG-PARK...113,40 € -
1 x AQP5-aquap...113,40 € -
1 x PRSS35-pro...121,50 € -
1 x GBL-G...121,50 € -
1 x CRLS1-card...113,40 €
No products
To be determined Shipping
3 032,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 032,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 032,35 €
View larger 
ASH2L-ash2 (absent, small, or homeotic)-like (Drosophila) Gene
PTXBC015936
New product
Data sheet of ASH2L-ash2 (absent, small, or homeotic)-like (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASH2L-ash2 (absent, small, or homeotic)-like (Drosophila) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC015936 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASH2L |
| Origin species: | Human |
| Product name: | ASH2L-ash2 (absent, small, or homeotic)-like (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC015936 |
| Gene id: | 9070 |
| Gene description: | ash2 (absent, small, or homeotic)-like (Drosophila) |
| Synonyms: | ASH2; ASH2L1; ASH2L2; Bre2; set1/Ash2 histone methyltransferase complex subunit ASH2; ASH2-like protein; ash2 (absent, small, or homeotic)-like; ASH2 like histone lysine methyltransferase complex subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatactcaggcgggctccgtggatgaagagaatggccgacagttgggtgaggtagagctgcaatgtgggatttgtacaaaatggttcacggctgacacatttggcatagatacctcatcctgtctacctttcatgaccaactacagttttcattgcaacgtctgccatcacagtgggaatacctatttcctccggaagcaagcaaacttgaaggaaatgtgccttagtgctttggccaacctgacatggcagtcccgaacacaggatgaacatccgaagacaatgttctccaaagataaggatattataccatttattgataaatactgggagtgcatgacaaccagacagagacctgggaaaatgacttggccaaataacattgttaaaacaatgagtaaagaaagagatgtattcttggtaaaggaacacccagatccaggcagtaaagatccagaagaagattaccccaaatttggacttttggatcaggaccttagtaacattggtcctgcttatgacaaccaaaaacagagcagtgctgtgtctactagtgggaatttaaatgggggaattgcagcaggaagcagcggaaaaggacgaggagccaagcgcaaacagcaggatggagggaccacagggaccaccaagaaggcccggagtgaccctttgttttctgctcagcgccttccccctcatggctacccattggaacacccgtttaacaaagatggctatcggtatattctagctgagcctgatccgcacgcccctgaccccgagaagctggaacttgactgctgggcaggaaaacctattcctggagacctctacagagcctgcttgtatgaacgggttttgttagccctacatgatcgagctccccagttaaagatctcagatgaccggctgactgtggttggagagaagggctactctatggtgagggcctctcatggagtacggaagggtgcctggtattttgaaatcactgtggatgagatgccaccagataccgctgccagactgggttggtcccagcccctaggaaaccttcaagctcctttaggttatgataaatttagctattcttggcggagcaaaaagggaaccaagttccaccagtccattggcaaacactactcttctggctatggacagggagacgtcctgggattttatattaatcttcctgaagacacagagacagccaagtcattgccagacacatacaaagataaggctttgataaaattcaagagttatttgtattttgaggaaaaagactttgtggataaagcagagaagagcctgaagcagactccccatagtgagataatattttataaaaatggtgtcaatcaaggtgtggcttacaaagatatttttgagggggtttacttcccagccatctcactgtacaagagctgcacggtttccattaactttggaccatgcttcaagtatcctccgaaggatctcacttaccgccctatgagtgacatgggctggggcgccgtggtagagcacaccctggctgacgtcttgtatcacgtggagacagaagtggatgggaggcgcagtcccccatgggaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, alpha 4 - protein tyrosine phosphatase, non-receptor type 23 - TSR1, 20S rRNA accumulation, homolog (S. cerevisiae) - vacuolar protein sorting 35 homolog (S. cerevisiae) |