Cart 6 Product Products 839,75 € (empty)
-
1 x SERPINA4-s...121,50 € -
-
1 x BRUNOL5-br...121,50 € -
1 x SERPINA10-...121,50 € -
1 x PMEPA1-pro...113,40 € -
1 x Phospho-HS...259,07 €
No products
To be determined Shipping
839,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 839,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 839,75 €
View larger 
CYP11A1-cytochrome P450, family 11, subfamily A, polypeptide 1 Gene
PTXBC032329
New product
Data sheet of CYP11A1-cytochrome P450, family 11, subfamily A, polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYP11A1-cytochrome P450, family 11, subfamily A, polypeptide 1 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC032329 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYP11A1 |
| Origin species: | Human |
| Product name: | CYP11A1-cytochrome P450, family 11, subfamily A, polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC032329 |
| Gene id: | 1583 |
| Gene description: | cytochrome P450, family 11, subfamily A, polypeptide 1 |
| Synonyms: | CYP11A; CYPXIA1; P450SCC; cholesterol side-chain cleavage enzyme, mitochondrial; cholesterol 20-22 desmolase; cholesterol monooxygenase (side-chain cleaving); cytochrome P450 11A1; cytochrome P450 family 11 subfamily A polypeptide 1; cytochrome P450(scc); cytochrome P450, subfamily XIA (cholesterol side chain cleavage); cytochrome P450C11A1; steroid 20-22-lyase; cytochrome P450 family 11 subfamily A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggccaagggtcttcccccacgctcagtcctggtcaaaggctgccagacctttctgagtgcccccagggaggggctggggcgtctcagggtgcccactggcgagggagctggcatctccacccgcagtcctcgccccttcaatgagatcccctctcctggtgacaatggctggctaaacctgtaccatttctggagggagacgggcacacacaaagtccaccttcaccatgtccagaatttccagaagtatggcccgatttacagggagaagctcggcaacgtggagtcggtttatgtcatcgaccctgaagatgtggcccttctctttaagtccgagggccccaacccagaacgattcctcatcccgccctgggtcgcctatcaccagtattaccagagacccataggagtcctgttgaagaagtcggcagcctggaagaaagaccgggtggccctgaaccaggaggtgatggctccagaggccaccaagaactttttgcccctgttggatgcagtgtctcgggacttcgtcagtgtcctgcacaggcgcatcaagaaggcgggctccggaaattactcgggggacatcagtgatgacctgttccgctttgcctttgagtccatcactaacgtcatttttggggagcgccaggggatgctggaggaagtagtgaaccccgaggcccagcgattcattgatgccatctaccagatgttccacaccagcgtccccatgctcaaccttcccccagacctgttccgtctgttcaggaccaagacctggaaggaccatgtggctgcatgggacgtgattttcagtaaagctgacatatacacccagaacttctactgggaattgagacagaaaggaagtgttcaccacgattaccgtggcatcctctacagactcctgggagacagcaagatgtccttcgaggacatcaaggccaacgtcacagagatgctggcaggaggggtggacacgacgtccatgaccctgcagtggcacttgtatgagatggcacgcaacctgaaggtgcaggatatgctgcgggcagaggtcttggctgcgcggcaccaggcccagggagacatggccacgatgctacagctggtccccctcctcaaagccagcatcaaggagacactaagacttcaccccatctccgtgaccctgcagagatatcttgtaaatgacttggttcttcgagattacatgattcctgccaagacactggtgcaagtggccatctatgctctgggccgagagcccaccttcttcttcgacccggaaaattttgacccaacccgatggctgagcaaagacaagaacatcacctacttccggaacttgggctttggctggggtgtgcggcagtgtctgggacggcggatcgctgagctagagatgaccatcttcctcatcaatatgctggagaacttcagagttgaaatccaacacctcagcgatgtgggcaccacattcaacctcattctgatgcctgaaaagcccatctccttcaccttctggccctttaaccaggaagcaacccagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 4, subfamily F, polypeptide 12 - TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) - polymerase (RNA) II (DNA directed) polypeptide E, 25kDa - protein phosphatase 1, regulatory (inhibitor) subunit 2 |