Cart 22 Product Products 3 466,50 € (empty)
-
1 x CLEC4E-C-t...113,40 € -
1 x RLBP1L2-re...121,50 € -
-
1 x IFRD2-inte...121,50 € -
1 x IFNA6-inte...113,40 € -
-
1 x CALM1-calm...113,40 € -
1 x OBFC2A-oli...113,40 € -
1 x Vaspin594,00 € -
1 x SUMF2-sulf...113,40 € -
1 x IFNA4-inte...113,40 € -
-
1 x IHPK2-inos...121,50 € -
1 x CCNJL-cycl...121,50 € -
1 x LEF1-lymph...121,50 € -
1 x HBEGF-hepa...113,40 € -
-
-
1 x HCCS-holoc...121,50 € -
1 x AP1S3-adap...113,40 € -
1 x SH3BGRL2-S...113,40 € -
1 x IDI1-isope...113,40 €
No products
To be determined Shipping
3 466,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 466,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 466,50 €
View larger 
SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene
PTXBC028216
New product
Data sheet of SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC028216 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC7A6 |
| Origin species: | Human |
| Product name: | SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene |
| Size: | 2ug |
| Accessions: | BC028216 |
| Gene id: | 9057 |
| Gene description: | solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 |
| Synonyms: | LAT-2; LAT3; y+LAT-2; Y+L amino acid transporter 2; amino acid permease; cationic amino acid transporter, y+ system; solute carrier family 7 (amino acid transporter light chain, y+L system), member 6; solute carrier family 7 (cationic amino acid transporter, y+ system), member 6; y(+)L-type amino acid transporter 2; y+LAT2; solute carrier family 7 member 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagccagggagcctgggaggcccacacccacctaccatcttgtccctaacaccagccagtcccaggtggaagaagatgtcagctcgccacctcaaaggtcctccgaaactatgcagctgaagaaggagatctccctgctgaatggggtcagcctggtggtgggcaacatgatcggctcagggatctttgtctcacccaagggtgtgctggtacacactgcctcctatgggatgtcactgattgtgtgggccattggtgggctcttctctgttgtgggtgccctttgttatgcagagctggggaccaccatcaccaagtcgggagccagctacgcttatattctagaggcctttgggggcttcattgccttcatccgcctgtgggtctcactgctagttgttgagcccaccggtcaggccatcatcgccatcacctttgccaactacatcatccagccgtccttccccagctgtgatcccccatacctggcctgccgtctcctggctgctgcttgcatatgtctgctgacatttgtgaactgtgcctatgtcaagtggggcacacgtgtgcaggacacgttcacttacgccaaggtcgtagcgctcattgccatcattgtcatgggccttgttaaactgtgccagggacactctgagcactttcaggacgcctttgagggttcctcctgggacatgggaaacctctctcttgccctctactctgccctcttctcttactcaggttgggacacccttaattttgtaacagaagaaatcaaaaacccagaaagaaatttgcccttggccattgggatttctatgccaattgtgacgctcatctacatcctgaccaatgtggcctattacacagtgctgaacatttcagatgtccttagcagtgatgctgtggctgtgacatttgctgaccagacgtttggcatgttcagctggaccatccccattgctgttgccctgtcctgctttgggggcctcaatgcatccatctttgcttcatcaaggttgttcttcgtgggctcccgggagggccacctaccggaccttctgtccatgatccacattgagcgttttacacctatccctgctttactgttcaattgcaccatggcactcatctacctcatcgtggaggatgttttccagcttatcaactacttcagcttcagctactggttcttcgtgggcctgtctgttgttggacagctctacctccgctggaaggagcccaagcggccccggcctctcaagctgagcgtgtttttccccatcgtgttctgcatatgctccgtgtttctggtgatagtgcccctcttcactgacaccattaattccctcattggcatcgggattgccctttctggagtccctttctacttcatgggtgtttacctgccagagtcccggaggccattgtttattcggaatgtcctggctgctatcaccagaggcacccagcagctttgcttttgtgtcctgactgagcttgatgtagccgaagaaaaaaaggatgagaggaaaactgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) - solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 |