Cart 18 Product Products 2 358,62 € (empty)
-
-
-
-
-
1 x APBB2-amyl...121,50 € -
1 x APOBEC3F-a...121,50 € -
1 x CCL7-chemo...113,40 € -
1 x IFNA1-inte...113,40 € -
-
1 x OBFC1-olig...121,50 € -
1 x ANKRA2-ank...121,50 € -
1 x AP3S1-adap...113,40 € -
-
1 x OCIAD1-OCI...113,40 € -
-
-
1 x TRAIL494,00 € -
No products
To be determined Shipping
2 358,62 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 358,62 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 358,62 €
View larger 
Data sheet of WAS-Wiskott-Aldrich syndrome (eczema-thrombocytopenia) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WAS-Wiskott-Aldrich syndrome (eczema-thrombocytopenia) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC012738 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WAS |
| Origin species: | Human |
| Product name: | WAS-Wiskott-Aldrich syndrome (eczema-thrombocytopenia) Gene |
| Size: | 2ug |
| Accessions: | BC012738 |
| Gene id: | 7454 |
| Gene description: | Wiskott-Aldrich syndrome (eczema-thrombocytopenia) |
| Synonyms: | IMD2; SCNX; THC; THC1; WASP; WASPA; wiskott-Aldrich syndrome protein; eczema-thrombocytopenia; thrombocytopenia 1 (X-linked); Wiskott-Aldrich syndrome |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgggggcccaatgggaggaaggcccgggggccgaggagcaccagcggttcagcagaacataccctccaccctcctccaggaccacgagaaccagcgactctttgagatgcttggacgaaaatgcttgacgctggccactgcagttgttcagctgtacctggcgctgccccctggagctgagcactggaccaaggagcattgtggggctgtgtgcttcgtgaaggataacccccagaagtcctacttcatccgcctttacggccttcaggctggtcggctgctctgggaacaggagctgtactcacagcttgtctactccacccccacccccttcttccacaccttcgctggagatgactgccaagcggggctgaactttgcagacgaggacgaggcccaggccttccgggccctcgtgcaggagaagatacaaaaaaggaatcagaggcaaagtggagacagacgccagctacccccaccaccaacaccagccaatgaagagagaagaggagggctcccacccctgcccctgcatccaggtggagaccaaggaggccctccagtgggtccgctctccctggggctggcgacagtggacatccagaaccctgacatcacgagttcacgataccgtgggctcccagcacctggacctagcccagctgataagaaacgctcagggaagaagaagatcagcaaagctgatattggtgcacccagtggattcaagcatgtcagccacgtggggtgggacccccagaatggatttgacgtgaacaacctcgacccagatctgcggagtctgttctccagggcaggaatcagcgaggcccagctcaccgacgccgagacctctaaacttatctacgacttcattgaggaccagggtgggctggaggctgtgcggcaggagatgaggcgccaggagccacttccgccgcccccaccgccatctcgaggagggaaccagctcccccggccccctattgtggggggtaacaagggtcgttctggtccactgccccctgtacctttggggattgccccacccccaccaacaccccggggacccccacccccaggccgagggggccctccaccaccaccccctccagctactggacgttctggaccactgccccctccaccccctggagctggtgggccacccatgccaccaccaccgccaccaccgccaccgccgcccagctccgggaatggaccagcccctcccccactccctcctgctctggtgcctgccgggggcctggcccctggtgggggtcggggagcgcttttggatcaaatccggcagggaattcagctgaacaagacccctggggccccagagagctcagcgctgcagccaccacctcagagctcagagggactggtgggggccctgatgcacgtgatgcagaagagaagcagagccatccactcctccgacgaaggggaggaccaggctggcgatgaagatgaagatgatgaatgggatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho guanine nucleotide exchange factor (GEF) 5 - fibronectin leucine rich transmembrane protein 1 - inner membrane protein, mitochondrial (mitofilin) - cyclin-dependent kinase 2 associated protein 2 |