Cart 13 Product Products 1 761,35 € (empty)
-
1 x C2orf76-ch...113,40 € -
1 x BCL7C-B-ce...113,40 € -
-
1 x C6orf208-c...113,40 € -
1 x FDC-SP...259,07 € -
-
-
1 x C19orf60-c...113,40 € -
1 x C15orf15-c...113,40 € -
1 x C3orf10-ch...113,40 € -
-
-
1 x PRKAB2-pro...121,50 €
No products
To be determined Shipping
1 761,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 761,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 761,35 €
Data sheet of PLD4-phospholipase D family, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLD4-phospholipase D family, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015003 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLD4 |
| Origin species: | Human |
| Product name: | PLD4-phospholipase D family, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC015003 |
| Gene id: | 122618 |
| Gene description: | phospholipase D family, member 4 |
| Synonyms: | C14orf175; phospholipase D4; PLD 4; choline phosphatase 4; phosphatidylcholine-hydrolyzing phospholipase D4; phospholipase D family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgccccgccgcccgtgggacagagaggctggcacgttgcaggtcctgggagcgctggctgtgctgtggctgggctccgtggctcttatctgcctcctgtggcaagtgccccgtcctcccacctggggccaggtgcagcccaaggacgtgcccaggtcctgggagcatggctccagcccagcttgggagcccctggaagcagaggccaggcagcagagggactcctgccagcttgtccttgtggaaagcatcccccaggacctgccatctgcagccggcagcccctctgcccagcctctgggccaggcctggctgcagctgctggacactgcccaggagagcgtccacgtggcttcatactactggtccctcacagggcctgacatcggggtcaacgactcgtcttcccagctgggagaggctcttctgcagaagctgcagcagctgctgggcaggaacatttccctggctgtggccaccagcagcccgacactggccaggacatccaccgacctgcaggttctggctgcccgaggtgcccatgtacgacaggtgcccatggggcggctcaccaggggtgttttgcactccaaattctgggttgtggatggacggcacatatacatgggcagtgccaacatggactggcggtctctgacgcaggtgaaggagcttggcgctgtcatctataactgcagccacctggcccaagacctggagaagaccttccagacctactgggtactgggggtgcccaaggctgtcctccccaaaacctggcctcagaacttctcatctcacttcaaccgtttccagcccttccacggcctctttgatggggtgcccaccactgcctacttctcagcgtcgccaccagcactctgtccccagggccgcacccgggacctggaggcgctgctggcggtgatggggagcgcccaggagttcatctatgcctccgtgatggagtatttccccaccacgcgcttcagccaccccccgaggtactggccggtgctggacaacgcgctgcgggcggcagccttcggcaagggcgtgcgcgtgcgcctgctggtcggctgcggactcaacacggaccccaccatgttcccctacctgcggtccctgcaggcgctcagcaaccccgcggccaacgtctctgtggacgtgaaagtcttcatcgtgccggtggggaaccattccaacatcccattcagcagggtgaaccacagcaagttcatggtcacggagaaggcagcctacataggcacctccaactggtcggaggattacttcagcagcacggcgggggtgggcttggtggtcacccagagccctggcgcgcagcccgcgggggccacggtgcaggagcagctgcggcagctctttgagcgggactggagttcgcgctacgccgtcggcctggacggacaggctccgggccaggactgcgtttggcagggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase D family, member 3 - tripartite motif-containing 22 - 4-aminobutyrate aminotransferase - ubiquitin specific peptidase 30 |