Cart 5 Product Products 584,17 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
No products
To be determined Shipping
584,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 584,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 584,17 €
View larger 
MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene
PTXBC002326
New product
Data sheet of MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002326 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPKAP1 |
| Origin species: | Human |
| Product name: | MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC002326 |
| Gene id: | 79109 |
| Gene description: | mitogen-activated protein kinase associated protein 1 |
| Synonyms: | TORC2 subunit MAPKAP1; target of rapamycin complex 2 subunit MAPKAP1; JC310; MIP1; SIN1; SIN1b; SIN1g; MEKK2-interacting protein 1; SAPK-interacting protein 1; mSIN1; mitogen-activated protein kinase 2-associated protein 1; ras inhibitor MGC2745; stress-activated map kinase interacting protein 1; stress-activated protein kinase-interacting 1; mitogen-activated protein kinase associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccttcttggacaatccaactatcattctagctcatattcgacagtcacatgtgaccagtgatgacacgggaatgtgtgagatggttctcattgatcatgatgttgacctagagaagattcatcctccttcaatgcctggagacagtgggtcagaaattcagggaagcaatggtgagactcagggctatgtatatgcccagtcagtcgatattacctcaagttgggactttggtattagaagacgctcaaacacagctcaaagattagaacgactccgaaaagagagacaaaaccagatcaaatgcaaaaatattcagtggaaagaaagaaattctaagcaatcagcccaggagttaaagtcactgtttgaaaaaaaatctctcaaagagaagcctccaatttctgggaagcagtcgatattatctgtacgcctagaacagtgccctctgcagctgaataacccttttaacgagtattccaaatttgatggcaagggtcatgtaggtacaacagcaaccaagaagatcgatgtctacctccctctgcactcgagccaggacagactgctgccaatgaccgtggtgacaatggccagcgccagggtgcaggacctgatcgggctcatctgctggcagtatacaagcgaaggacgggagccgaagctcaatgacaatgtcagtgcctactgcctgcatattgctgaggatgatggggaggtggacaccgatttccccccgctggattccaatgagcccattcataagtttggcttcagtactttggccctggttgaaaagtactcatctcctggtctgacatccaaagagtcactctttgttcgaataaatgctgctcatggattctcccttattcaggtggacaacacaaaggttaccatgaaggaaatcttactgaaggcagtgaagcgaagaaaaggatcccagaaagtttcaggttcaagggcagacggggtttttgaggaggattcgcaaattgacatagccacagtacaggatatgcttagcagccaccattacaagtcattcaaagtcagcatgatccacagactgcgattcacaaccgacgtacagctaggtatctctggagacaaagtagagatagaccctgttacgaatcagaaagccagcactaagttttggattaagcagaaacccatctcaatcgattccgacctgctctgtgcctgtgaccttgctgaagagaaaagccccagtcacgcaatatttaaactcacgtatctaagcaatcacgactataaacacctctactttgaatcggacgctgctaccgtcaatgaaattgtgctcaaggttaactacatcctggaatcgcgagctagcactgcccgggctgactactttgctcaaaaacaaagaaaactgaacagacgtacgagcttcagcttccagaaggagaagaaatccgggcagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class V - glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 - UDP glucuronosyltransferase 1 family, polypeptide A10 - serine palmitoyltransferase, long chain base subunit 2 |