Cart 1 Product Products 113,40 € (empty)
-
1 x C21orf49-c...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
AGT-angiotensinogen (serpin peptidase inhibitor, clade A, member 8) Gene
PTXBC011519
New product
Data sheet of AGT-angiotensinogen (serpin peptidase inhibitor, clade A, member 8) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGT-angiotensinogen (serpin peptidase inhibitor, clade A, member 8) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011519 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGT |
| Origin species: | Human |
| Product name: | AGT-angiotensinogen (serpin peptidase inhibitor, clade A, member 8) Gene |
| Size: | 2ug |
| Accessions: | BC011519 |
| Gene id: | 183 |
| Gene description: | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) |
| Synonyms: | ANHU; SERPINA8; angiotensinogen; alpha-1 antiproteinase, antitrypsin; angiotensin I; angiotensin II; pre-angiotensinogen; serine (or cysteine) proteinase inhibitor; serpin A8; serpin peptidase inhibitor, clade A, member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatgccgggaagcccaaagaccccaccttcatacctgctccaattcaggccaagacatcccctgtggatgaaaaggccctacaggaccagctggtgctagtcgctgcaaaacttgacaccgaagacaagttgagggccgcaatggtcgggatgctggccaacttcttgggcttccgtatatatggcatgcacagtgagctatggggcgtggtccatggggccaccgtcctctccccaacggctgtctttggcaccctggcctctctctatctgggagccttggaccacacagctgacaggctacaggcaatcctgggtgttccttggaaggacaagaactgcacctcccggctggatgcgcacaaggtcctgtctgccctgcaggctgtacagggcctgctagtggcccagggcagggctgatagccaggcccagctgctgctgtccacggtggtgggcgtgttcacagccccaggcctgcacctgaagcagccgtttgtgcagggcctggctctctatacccctgtggtcctcccacgctctctggacttcacagaactggatgttgctgctgagaagattgacaggttcatgcaggctgtgacaggatggaagactggctgctccctgacgggagccagtgtggacagcaccctggctttcaacacctacgtccacttccaagggaagatgaagggcttctccctgctggccgagccccaggagttctgggtggacaacagcacctcagtgtctgttcccatgctctctggcatgggcaccttccagcactggagtgacatccaggacaacttctcggtgactcaagtgtccttcactgagagcgcctgcctgctgctgatccagcctcactatgcctctgacctggacaaggtggagggtctcactttccagcaaaactccctcaactggatgaagaaactgtctccccggaccatccacctgaccatgccccaactggtgctgcaaggatcttatgacctgcaggacctgctcgcccaggctgagctgcccgccattctgcacaccgagctgaacctgcaaaaattgagcaatgaccgcatcagggtgggggaggtgctgaacagcattttttttgagcttgaagcggatgagagagagcccacagagtctacccaacagcttaacaagcctgaggtcttggaggtgaccctgaaccgcccattcctgtttgctgtgtatgatcaaagcgccactgccctgcacttcctgggccgcgtggccaacccgctgagcacagcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 - solute carrier family 33 (acetyl-CoA transporter), member 1 - retinitis pigmentosa GTPase regulator interacting protein 1 - solute carrier organic anion transporter family, member 3A1 |