Cart 6 Product Products 842,27 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 €
No products
To be determined Shipping
842,27 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 842,27 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 842,27 €
View larger 
SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene
PTXBC015770
New product
Data sheet of SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015770 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A14 |
| Origin species: | Human |
| Product name: | SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene |
| Size: | 2ug |
| Accessions: | BC015770 |
| Gene id: | 23516 |
| Gene description: | solute carrier family 39 (zinc transporter), member 14 |
| Synonyms: | HMNDYT2; LZT-Hs4; NET34; ZIP14; cig19; zinc transporter ZIP14; LIV-1 subfamily of ZIP zinc transporter 4; ZIP-14; Zrt-, Irt-like protein 14; solute carrier family 39 (metal ion transporter), member 14; solute carrier family 39 (zinc transporter), member 14; zrt- and Irt-like protein 14; solute carrier family 39 member 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctgctgctgctgcacccggccttccagagctgcctcctgctgaccctgcttggcttatggagaaccacccctgaggctcacgcttcatccccgggtgcaccagctatcagcgctgcctccttcctgcaggatctaatacatcggtatggcgagggtgacagcctcactctgcagcagctgaaggccctgctcaaccacctggatgtgggagtgggccggggtaatgtcacccagcacgtgcaaggacacaggaacctctccacgtgctttagttctggagacctcttcactgcccacaatttcagcgagcagtcgcggattgggagcagcgagctccaggagttctgccccaccatcctccagcagctggattcccgggcctgcacctcggagaaccaggaaaacgaggagaatgagcagacggaggaggggcggccaagcgctgttgaagtgtggggatacggtctcctctgtgtgaccgtcatctccctctgctccctcctgggggccagcgtggtgcccttcatgaagaagaccttttacaagaggctgctgctctacttcatagctctggcgattggaaccctctactccaacgccctcttccagctcatcccggaggcatttggtttcaaccctctggaagattattatgtctccaagtctgcagtggtgtttgggggcttttatcttttctttttcacagagaagatcttgaagattcttcttaagcagaaaaatgagcatcatcatggacacagccattatgcctctgagtcgcttccctccaagaaggaccaggaggagggggtgatggagaagctgcagaacggggacctggaccacatgattcctcagcactgcagcagtgagctggacggcaaggcgcccatggtggacgagaaggtcattgtgggctcgctctctgtgcaggacctgcaggcttcccagagtgcttgctactggctgaaaggtgtccgctactctgatatcggcactctggcctggatgatcactctgagcgacggcctccataatttcatcgatggcctggccatcggtgcttccttcactgtgtcagttttccaaggcatcagcacctcggtggccatcctctgtgaggagttcccacatgagctaggagactttgtcatcctgctcaacgctgggatgagcatccaacaagctctcttcttcaacttcctttctgcctgctgctgctacctgggtctggcctttggcatcctggccggcagccacttctctgccaactggatttttgcgctagctggaggaatgttcttgtatatttctctggctgatatgatggagttttgctctgttgcccaggctggagtgcaatggtgccatctcagctcactgcaacctctgccgcttgggttgaagcgattatcctgtctaagcctcccgagtaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - multiple inositol polyphosphate histidine phosphatase, 1 - CAP-GLY domain containing linker protein family, member 4 - ATP-binding cassette, sub-family C (CFTR/MRP), member 11 - adenosine deaminase domain containing 1 (testis-specific) |