Cart 48 Product Products 7 469,29 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x ZPBP-zona...121,50 € -
1 x DUSP26-dua...113,40 € -
1 x GCSH-glyci...113,40 € -
1 x PLEKHO2-pl...121,50 € -
1 x MMP13-matr...121,50 € -
1 x BST2-bone...113,40 € -
1 x SURF6-surf...121,50 € -
1 x RPS16-ribo...113,40 € -
1 x RPL13-ribo...113,40 € -
1 x RPSA-ribos...121,50 € -
1 x LRP3...259,07 € -
1 x DCI-dodece...113,40 € -
1 x GINS2-GINS...113,40 € -
1 x TUBA3E-tub...121,50 € -
1 x TMEM183A-t...121,50 € -
1 x BBOX1-buty...121,50 € -
1 x SLC17A5-so...121,50 € -
1 x GBA3-gluco...113,40 € -
1 x GATA-2/3...259,07 € -
1 x LRP1...259,07 € -
1 x KIR2DL3-ki...121,50 € -
1 x LAPTM4B-ly...113,40 € -
1 x PTPN11-pro...121,50 € -
1 x GIPC3-GIPC...121,50 € -
-
1 x MGC42157-h...113,40 € -
1 x TNFRSF14-t...113,40 € -
1 x VPS28-vacu...113,40 € -
1 x DYNLRB1-dy...113,40 € -
1 x XKR6-XK,...121,50 € -
1 x CAV2-caveo...113,40 € -
1 x TPT1-tumor...113,40 € -
1 x IHPK2-inos...121,50 € -
1 x NUMB-numb...113,40 € -
1 x DCXR-dicar...113,40 € -
1 x ZZZ3-zinc...121,50 € -
-
1 x SPRR1B-sma...113,40 € -
1 x RBKS-ribok...121,50 €
No products
To be determined Shipping
7 469,29 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 48 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 469,29 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 469,29 €
Data sheet of FLJ20628-hypothetical protein FLJ20628 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ20628-hypothetical protein FLJ20628 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000952 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ20628 |
| Origin species: | Human |
| Product name: | FLJ20628-hypothetical protein FLJ20628 Gene |
| Size: | 2ug |
| Accessions: | BC000952 |
| Gene id: | 55006 |
| Gene description: | hypothetical protein FLJ20628 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctaatggcatggtgccgcggtcctgtcttgctgtgcctgcggcaggggctcggaaccaattcattcctgcacggcctggggcaggagcccttcgagggagctcggtcactgtgttgcaggtcctcgcctagagacctgcgagatggagaaagagagcacgaggcggcacaaaggaaagccccaggagcagagtcttgcccatctctccctctgagcatctcggacattgggactggatgtctttcgtcactggaaaacctcagactgccgacgctgcgggaagagtcatcacctcgagagctcgaggactcgagcggagaccagggccggtgcggtcccacacaccagggatccgaggatccttcgatgctctcgcaggcccagtccgctatcgaggtcgaagagcgtcacgtctccccttcttgttcaacttccagagagagaccctttcaggctggggagctgattttagctgagactggggagggagaaacaaaatttaagaaattatttaggttgaacaacttcggactcttaaatagtaactggggggcagtcccgttcggcaagatcgtggggaagttccccggccagatactgaggagttccttcggtaagcagtacatgctgaggaggccagccttggaagactatgtagtattgatgaaaagagggactgccataacattcccaaaggatattaatatgattctctcaatgatggatatcaacccaggtgatactgttttggaagctggctcaggctctggtggaatgagcttatttttatccaaagcagttggatcacaaggacgagtcataagttttgaggtacgaaaagaccaccatgatctggctaagaagaattacaaacactggcgtgattcatggaaattaagtcatgtagaagagtggccagacaatgtggattttattcataaggacatttcaggagcaaccgaagacataaaatctttaacatttgacgcagtagctttggatatgttaaatcctcatgttactttgcctgttttttacccacatcttaagcatggtggtgtatgtgctgtatatgtagtaaacatcacacaggttattgaacttttagatggaattcgcacctgtgaacttgctctttcatgtgaaaagataagcgaggtcattgtcagagattggttggtttgccttgcaaaacagaaaaatggaattttagctcaaaaagtagaatctaaaatcaacacagatgtacaactagattctcaagagaaaattggagttaaaggtgagctgtttcaagaggatgaccatgaagaatcgcattctgattttccatatggatcatttccctatgttgctagaccagtacactggcaacctggtcatacagcttttcttgtcaagttgaggaaggtcaaaccacaacttaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual specificity phosphatase 10 - TNF receptor-associated factor 2 - 24-dehydrocholesterol reductase - UHRF1 binding protein 1-like |