Cart 97 Product Products 12 453,17 € (empty)
-
1 x GPR3-G...121,50 € -
1 x CD2BP2-CD2...121,50 € -
1 x DULLARD-du...113,40 € -
1 x FAM170A-fa...121,50 € -
1 x ORMDL1-ORM...113,40 € -
1 x TOMM34-tra...121,50 € -
1 x LMX1B-LIM...121,50 € -
-
1 x LIMS1-LIM...121,50 € -
-
1 x CD99-CD99...113,40 € -
1 x LILRB4-leu...121,50 € -
1 x COX4...259,07 € -
1 x CD4-CD4...121,50 € -
1 x TPRKB-TP53...113,40 € -
-
-
-
1 x TSPAN32-te...113,40 € -
1 x C15orf38-c...113,40 € -
1 x Olfactory...259,07 € -
-
-
1 x PRR3-proli...113,40 € -
-
-
1 x TNFAIP8-tu...113,40 € -
-
-
-
1 x CXCR3-chem...121,50 € -
1 x TSSK4-test...113,40 € -
1 x UPB1-ureid...121,50 € -
-
-
-
1 x SLC1A6-sol...121,50 € -
1 x SLC25A22-s...121,50 € -
1 x MRPS25-mit...113,40 € -
1 x PEA15-phos...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x BLZF1-basi...121,50 € -
1 x Rabaptin-5...259,07 € -
1 x MRFAP1L1-M...113,40 € -
1 x HSP90A...259,07 € -
-
-
-
1 x KHDC1-KH...113,40 € -
1 x SEC14L4-SE...121,50 € -
1 x MRGPRE-MAS...121,50 € -
1 x Nibrin...259,07 € -
-
1 x C20orf12-c...113,40 € -
1 x NLRP1-NLR...113,40 € -
1 x TWISTNB-TW...121,50 € -
1 x KRT8P12-ke...113,40 € -
1 x TADA2B-tra...121,50 € -
-
1 x ERAL1-Era...121,50 € -
1 x ATXN7L1-at...113,40 € -
-
-
1 x ISG15-ISG1...113,40 € -
1 x MXRA8-matr...121,50 € -
1 x C4orf38-ch...113,40 € -
-
-
-
1 x ELAVL3-ELA...121,50 € -
1 x IL12RB1-in...121,50 € -
-
1 x MRPL32-mit...113,40 € -
1 x TOMM7-tran...113,40 € -
1 x MAPK8-mito...121,50 € -
1 x C13orf30-c...113,40 € -
-
1 x KCNIP3-Kv...113,40 € -
1 x TMOD3-trop...121,50 € -
1 x FLJ12529-p...121,50 € -
-
-
1 x BCL2L1-BCL...113,40 € -
1 x PDIA6-prot...121,50 € -
1 x FAM167A-fa...113,40 € -
-
1 x C12orf54-c...113,40 € -
1 x ELL3-elong...121,50 € -
1 x MCEE-methy...113,40 € -
1 x SPATA12-sp...113,40 € -
-
1 x CHMP2A-chr...113,40 € -
1 x RBBP9-reti...113,40 € -
1 x NARG2-NMDA...121,50 € -
1 x STARD3-StA...121,50 € -
1 x PARVA-parv...121,50 € -
-
No products
To be determined Shipping
12 453,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 97 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 12 453,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 12 453,17 €
Data sheet of PNLIP-pancreatic lipase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PNLIP-pancreatic lipase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014309 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PNLIP |
| Origin species: | Human |
| Product name: | PNLIP-pancreatic lipase Gene |
| Size: | 2ug |
| Accessions: | BC014309 |
| Gene id: | 5406 |
| Gene description: | pancreatic lipase |
| Synonyms: | PNLIPD; PTL; pancreatic triacylglycerol lipase; triacylglycerol acylhydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgccactttggactctttcactgctgctgggagcagtagcaggaaaagaagtttgctacgaaagactcggctgcttcagtgatgactccccatggtcaggaattacggaaagacccctccatatattgccttggtctccaaaagatgtcaacacccgcttcctcctatatactaatgagaacccaaacaactttcaagaagttgccgcagattcatcaagcatcagtggctccaatttcaaaacaaatagaaaaactcgctttattattcatggattcatagacaagggagaagaaaactggctggccaatgtgtgcaagaatctgttcaaggtggaaagtgtgaactgtatctgtgtggactggaaaggtggctcccgaactggatacacacaagcctcgcagaacatcaggatcgtgggagcagaagtggcatattttgttgaatttcttcagtcggcgttcggttactcaccttccaacgtgcatgtcattggccacagcctgggtgcccacgctgctggggaggctggaaggagaaccaatgggaccattggacgcatcacagggttggacccagcagaaccttgctttcagggcacacctgaattagtccgattggaccccagcgatgccaaatttgtggatgtaattcacacggatggtgcccccatagtccccaatttggggtttggaatgagccaagtcgtgggccacctagatttctttccaaatggaggagtggaaatgcctggatgtaaaaagaacattctctctcagattgtggacatagacggaatctgggaagggactcgagactttgcggcctgtaatcacttaagaagctacaaatattacactgatagcatcgtcaaccctgatggctttgctggattcccctgtgcctcttacaacgtcttcactgcaaacaagtgtttcccttgtccaagtggaggctgcccacagatgggtcactatgctgatagatatcctgggaaaacaaatgatgtgggccagaaattttatctagacactggtgatgccagtaattttgcacgttggaggtataaggtatctgtcacactgtctggaaaaaaggttacaggacacatactagtttctttgttcggaaataaaggaaactctaagcagtatgaaattttcaagggcactctcaaaccagatagtactcattccaatgaatttgactcagatgtggatgttggggacttgcagatggttaaatttatttggtataacaatgtgatcaacccaactttacctagagtgggagcatccaagattatagtggagacaaatgttggaaaacagttcaacttctgtagtccagaaaccgtcagggaggaagttctgctcaccctcacaccgtgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleoporin 54kDa - squalene epoxidase - integrin, alpha 9 - F-box protein 30 |